Overview

Comprehensive Description

Biology

Secretive species found in lagoon and seaward reef slopes in areas with rich coral growth. Found singly or in aggregations (Ref. 1602); forms harems of 3-7 individuals. Feeds on algae. Frequently exported through the aquarium trade (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Tuamoto Islands, north to the Izu Island, south to Lord Howe Island. Not found in the Red Sea, Hawaii, and the southern Pacific Ocean (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widely dispersed in the tropical Indo-Pacific region. It ranges from East Africa (Tanzania, Mozambique, South Africa) to the Tuamotu Islands (French Polynesia) in the South Pacific, extending northwards to the Izu Islands (Japan), and as far south as Lord Howe Island (to Australia) (Pyle 2001, G.R. Allen pers. comm. 2006). It is not found in the Red Sea, Hawaii (USA), and southeastern Pacific Ocean (Pyle 2001). Found at depths of five to 50 m (Pyle 2001, G.R. Allen pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, Aldabra, Madagascar and Mascarenes east to Marshall and Tuamotu islands, north to Izu Islands, south to Western Australia, Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 16 - 18; Analspines: 3; Analsoft rays: 17 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 5953))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color in life variable; predominantly light orange with the barring broken into a series of spots; others almost entirely purple. Often very pale in deep water and bright orange form in the Pacific that looks near identical to C. aurantia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 9 - 45 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is associated with coral reefs of lagoons, rubble areas and exposed outer slopes. It is most abundant on outer reef drop-offs (Pyle 1991, G.R. Allen pers. comm. 2006). It can be found as single animals or in aggregations, often as harems of three to seven individuals (Myers 1991, Pyle 1991). This species feeds on algae (Myers 1991, Pyle 1991).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 111 specimens in 1 taxon.
Water temperature and chemistry ranges based on 61 samples.

Environmental ranges
  Depth range (m): 1.75 - 39.5
  Temperature range (°C): 24.633 - 28.905
  Nitrate (umol/L): 0.019 - 1.118
  Salinity (PPS): 33.913 - 35.924
  Oxygen (ml/l): 4.387 - 4.851
  Phosphate (umol/l): 0.070 - 0.238
  Silicate (umol/l): 0.721 - 3.715

Graphical representation

Depth range (m): 1.75 - 39.5

Temperature range (°C): 24.633 - 28.905

Nitrate (umol/L): 0.019 - 1.118

Salinity (PPS): 33.913 - 35.924

Oxygen (ml/l): 4.387 - 4.851

Phosphate (umol/l): 0.070 - 0.238

Silicate (umol/l): 0.721 - 3.715
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 9 - 45m.
From 9 to 45 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Secretive species found in lagoon and seaward reef slopes in areas with rich coral growth. Found singly or in aggregations.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge bispinosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTATTTATTATTTGGTGCTTGAGCTGGGATAGTAGGTACAGCTTTAAGCCTGCTTATCCGAGCAGAACTTAATCAGCCAGGCAGCCTCCTTGGAGATGACCAAATCTACAATGTTATCGTTACAGCACATGCGTTTGTAATAATTTTTTTTATAGTTATACCGGCCATAATCGGAGGATTTGGAAACTGACTGGTCCCACTAATAATTGGGGCCCCAGACATGGCATTCCCCCGAATGAATAATATAAGCTTTTGACTCCTGCCCCCCTCCCTTCTTCTTCTCCTAGCTTCTGCTGGCGTAGAAGCCGGGGCCGGCACTGGATGGACAGTTTACCCCCCTCTAGCTGGCAACCTAGCCCACGCAGGTGCATCAGTAGACTTAACCATCTTCTCCCTCCACCTAGCAGGGGTTTCCTCAATTTTAGGAGCTATTAATTTCATCACCACAATTATTAATATGAAACCTCCAGCTATTTCCCAGTACCAGACACCTTTATTTGTCTGAGCAGTACTAATTACAGCAGTCCTCCTACTTCTCTCCCTTCCAGTCCTTGCGGCGGGGATTACAATGCTTCTCACAGACCGAAACCTCAATACCACTTTCTTCGACCCCGCAGGGGGAGGAGACCCAATTCTTTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge bispinosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R. & Myers, R.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large overall population, collection for the aquarium fish trade is not globally impacting the population, and there are no other potential major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

It is generally common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

There appear to be no major threats to this species. Although it is often collected for the aquarium trade, harvest levels are not considered to be impacting the global population. There is no substantial habitat loss in the range of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is believed to be present within a number of marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Twospined angelfish

The Twospined Angelfish, Dusky Angelfish, or Coral Beauty (Centropyge bispinosa), is a marine angelfish.

Some individuals have a dark purplish blue body with yellow to red stripes, and usually an electric blue rim; in others are orange stripes dominate, with the purple distributed in spots. Some bright orange forms are very similar in appearance to the golden angelfish, Centropyge aurantia.

The twospined angelfish is native to the Indo-Pacific where it lives in coral reefs and lagoons. It reaches a maximum length of 3 inches (8 cm). It eats algae.

When kept in an aquarium they may have a tendency to nip on corals, especially soft corals and clam mantles. This species is suitable for beginners, as it is considered one of the hardier dwarf angels. Due to their high metabolisms, feeding usually needs to be done at least every other day. Once established, they are generally a long-lived species. There is also a deep water version of this species.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!