Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Often found offshore, up to 500 miles from the coast (Ref. 9283). Forms large schools (Ref. 2850). Young frequently occur in school near kelp and under piers (Ref. 2850). Feeds mainly on small crustaceans and fish larvae (Ref. 9283). Large individuals often move inshore and north in the summer (Ref. 2850). Marketed fresh, smoked, canned and frozen; eaten fried, broiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: jackmackerel (English), charrito (Espanol), chicharo (Espanol)
 
Trachurus symmetricus (Ayres, 1855)


Pacific jackmackerel



Elongate, slender, moderately compressed; teeth small, a single row on each jaw; no papillae at front of shoulder at edge of gill chamber; eye with fatty eyelid; gill rakers (excluding rudiments) 14-18 + 38-43; dorsal fin VIII + I, 31-33; anal fin with II isolated spines + I, 26-30; dorsal and anal fins without isolated finlets behind main part of fins; pectoral fins long, reach past origin of anal fin; well developed, vertically expanded scutes (large spiny scales) on both curved and straight parts of lateral line, those on curved part of the lateral line relatively small (25-45% of eye diameter); with an accessory lateral line along top of back under spiny dorsal fin; scales obvious over all of body except just behind pectoral fin.


Metallic blue to olive green on back, lower two-thirds paler, usually whitish to silvery; a black spot on upper edge of gill opening.


Size: reaches about 81 cm, common to 55 cm.

Habitat: a coastal pelagic species.
Depth: 0-400 m.

Alaska to the tip of Baja and the SW Gulf of California.


T. murphyi which occurs in the southern part of our region is the sister species of T. symmetricus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: southeastern Alaska to southern Baja California, Mexico and the Gulf of California; reported from Acapulco in Mexico and the Galapagos Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This northeastern Pacific species is found from from Alaska to the tip of Baja.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 400 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 28 - 38; Anal spines: 1 - 2; Analsoft rays: 22 - 33; Vertebrae: 23 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 81.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 810 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

81.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 30 years (Ref. 766)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Small specimens may have an additional forward-directed spine at first dorsal origin (embedded in larger specimens).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Decapterus polyaspis
Catalog Number: USNM 143676
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock
Year Collected: 1937
Locality: Oregon, Off Reedsport, Douglas County, Oregon, United States, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 400 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This pelagic oceanodromous species is often found offshore, up to 500 miles from the coast (Smith-Vaniz 1995) to depths of 400m. It forms large schools; the young frequently occur in schools near kelp and under piers (Eschmeyer et al. 1983). It feeds mainly on small crustaceans and fish larvae (Smith-Vaniz 1995). Large individuals often move inshore and north in the summer (Eschmeyer et al. 1983).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 1 - 366
  Temperature range (°C): 6.337 - 24.488
  Nitrate (umol/L): 0.075 - 37.473
  Salinity (PPS): 33.135 - 35.023
  Oxygen (ml/l): 0.900 - 5.885
  Phosphate (umol/l): 0.327 - 2.881
  Silicate (umol/l): 2.399 - 66.754

Graphical representation

Depth range (m): 1 - 366

Temperature range (°C): 6.337 - 24.488

Nitrate (umol/L): 0.075 - 37.473

Salinity (PPS): 33.135 - 35.023

Oxygen (ml/l): 0.900 - 5.885

Phosphate (umol/l): 0.327 - 2.881

Silicate (umol/l): 2.399 - 66.754
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 400m.
Recorded at 400 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Often found offshore, up to 500 miles from the coast (Ref. 9283). Forms large schools (Ref. 2850). Young frequently occur in school near kelp and under piers (Ref. 2850). Feeds mainly on small crustaceans and fish larvae (Ref. 9283). Large individuals often move inshore and north in the summer (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore, Planktivore

Diet: Pelagic crustacea, zooplankton, pelagic fish eggs, pelagic fish larvae, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Trachurus symmetricus (jack mackerel) preys on:
zooplankton
detritus

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Trachurus symmetricus (jack mackerel) is prey of:
Sebastes miniatus
Scorpaena guttata
Zalophus californianus

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachurus symmetricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACCGCTTTAAGCCTGCTTATTCGGGCAGAACTAAGCCAACCTGGCGCCCTTCTAGGGGATGACCAAATTTACAACGTAATTGTTACGGCCCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTGATTCCACTAATGATCGGAGCCCCTGATATAGCCTTCCCTCGAATGAATAACATGAGCTTCTGACTACTCCCTCCCTCCTTCCTTTTGCTTTTAGCCTCTTCAGGTGTTGAAGCCGGGGCCGGAACTGGTTGAACAGTCTATCCCCCACTGGCTGGGAACCTTGCCCACGCCGGAGCATCCGTAGATTTAACCATCTTCTCCCTTCACCTAGCAGGGGTCTCATCAATTCTAGGGGCTATTAACTTTATTACCACTATTATCAACATGAAACCTCCTGCAGTCTCAATATATCAAATCCCACTATTTGTTTGAGCTGTCTTAATTACAGCTGTCCTTCTTCTTCTCTCTCTTCCTGTCCTAGCTGCTGGCATTACAATACTTTTAACAGACCGAAATCTAAATACTGCTTTCTTTGACCCAGCAGGCGGGGGAGACCCAATTCTTTATCAACACCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trachurus symmetricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Smith-Vaniz, B, Robertson, R., Dominici-Arosemena, A.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Justification
This species is widespread in the northeastern Pacific. Although this species is commercially fished, including as bycatch, there is no current indication of widespread population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. This species can be locally abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Although this species is caught in commercial fisheries, it is not thought to be experiencing any widespread population decline from the fishery.

This species is caught in commercial fisheries, sometimes as bycatch.This is an important sport fish, and is a bait fish. In the commercial fisheries it is caught with purse seines in mixed schools (Scomber japonicus). Also caught with round-hull nets.This species is utilized canned and fresh, and for fish meal.

Landing: mainly USA in area 77 - from 1,000 to 10,000. It is typically caught with seines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pacific jack mackerel

The Pacific jack mackerel,Trachurus symmetricus (also known as the Californian jack mackerel or simply jack mackerel), is an abundant species of pelagic marine fish in the jack family, Carangidae. The species is distributed along the western coast of North America, ranging from Alaska in the north to the Gulf of California in the south, inhabiting both offshore and inshore environments. The Pacific jack mackerel is a moderately large fish, growing to a maximum recorded length of 81 cm, although commonly seen below 55 cm. It is very similar in appearance to other members of its genus, Trachurus, especially Trachurus murphyi, which was once thought to be a subspecies of T. symmetricus, and inhabits waters further south. Pacific jack mackerel travel in large schools, ranging up to 600 miles offshore and to depths of 400 m, generally moving through the upper part of the water column.

Contents

Taxonomy and naming

The Pacific jack mackerel is classified within the genus Trachurus, commonly known as the horse mackerels or jack mackerels. Trachurus is part of the jack family Carangidae, a group of perciform fish in the suborder Percoidei.[1] Recent genetic studies have divided the Carangidae into four subfamilies, with the genus Trachurus falling into the 'Caranginae' (or tribe Carangini), being most closely related to the 'scads' of the genera Decapterus and Selar.[2][3]

The species was first scientifically described by William Orville Ayres in 1855 based on the holotype specimen taken from San Francisco Bay, California.[4] He named the species Caranx symmetricus, correctly identifying its relationship to the jacks, but incorporating it into what was later found to be the wrong genus. The fish was redescribed in 1944 under a different name, Decapterus polyaspis, from a specimen caught in Oregon,[5] which under the ICZN rules classifies as a junior synonym, and it is therefore discarded. In 1983, C. symmetricus was transferred to Trachurus symmetricus by William N. Eschmeyer and Earl Herald. The species has twice been treated as a subspecies; once as Trachurus picturatus symmetricus (a subspecies of the blue jack mackerel), and the second more commonly used subspecies of Trachurus symmetricus symmetricus. For many years, the latter was accepted as a valid combination, with Trachurus symmetricus murphyi considered to be a southern subspecies population. Mitochondrial DNA analysis has now confirmed these subspecies to be separate species, with T. s. murphyi now simply Trachurus murphyi, the Inca scad. The divergence time of these two species was deemed relatively recent, at around 250 000 years ago.[6]

T. symmetricus is known commonly as the 'Pacific jack mackerel' in reference to its distribution, with the species often called simply 'jack mackerel' or 'mackereljack'[7]

Description

The Pacific jack mackerel is very similar to all other members of Trachurus and a number of other carangid genera, having an elongate, slightly compressed body with both the dorsal and ventral profiles of the body having the same degree of curvature.[8] It is a medium- to large-sized fish, growing to a maximum known length of 81 cm (32 in), although more common at below 55 cm.[7] There two separate dorsal fins are composed of eight spines and one spine followed by 31 to 35 soft rays, respectively. The anal fin is composed of two spines anteriorly detached followed by one spine connected to 26 to 30 soft rays. In some larger individuals, the last few rays at the posterior of the soft dorsal and anal fins are almost entirely separate from the rest of the fin, forming finlets.[8] The caudal fin is strongly forked, typical amongst the Carangidae, while the ventral fin consists of 1 spine and five soft rays. The pectoral fin terminates before the front of the anal fin, having 22 to 24 rays in total. The lateral line dips strongly after the pectoral fin, having 50 to 53 scales on the upper section and 43 to 52 keeled scutes posteriorly. The species teeth are minute, with a patch of teeth on the tongue in a narrow club shaped strip. There are 24 vertebrae in total.[8]

Pacific jack mackerel are metallic blue to olive-green dorsally, becoming more silvery ventrally, before transitioning to a white belly. The top of the head and area near eye is quite dark with a dark spot on the upper rear of the gill cover. The fins are mostly hyaline to dusky, although caudal fin may be yellow to reddish.[5]

Distribution and habitat

The Pacific jack mackerel is distributed through the eastern Pacific Ocean from Alaska in the north, down the western North American seaboard to the Baja California peninsula in the Gulf of California.[7] It has been reported as far south as the Galápagos Islands, however at these latitudes it would be sympatric with T. murphyi, possibly resulting in confusion of the two species. Pacific jack mackerel occur in both pelagic and inshore environments, often venturing up to 600 miles offshore and to known depths of 400 m. In more coastal environments they are known to inhabit bays and very shallow waters.[8]

Relationship to humans

A swirling mass of Pacific jack mackerel form a bait ball which draws feeding seabirds and marine mammals.

Pacific jack mackerel are fished commercially as well as for sport. They are often caught on baited hook from piers and boats, and also while salmon trolling. Commercial fishing occurs along the coast. Large individuals often move inshore and north in the summer.

Pacific jack mackerel is canned in the same manner as salmon. Fish are cleaned, gutted and finned, then packed into cans with salt and water.

History

Before 1947 the pacific jack mackerel was of minor importance. It was referred to as horse mackerel, and had little market appeal. However, in 1948, the US. Pure Food and Drug Administration decided to allow the use of "jack mackerel" on all labeling, and it affected its appeal. The new label combined with low catches of Pacific sardine in 1947-48 and increased catches of pacific jack mackerel during the same time, resulted in the fish gaining importance.[9] In the past mackerel consumption was considered a sign of low income. In the American segregated Southern states, it was often associated with black Americans. Today, most of these stereotypes are gone.

Other

Pacific jack mackerel tastes similar to canned sardines. It may be used interchangeably with salmon or tuna in recipes. Jack mackerel is considered safer to consume than tuna because it is a smaller fish, and not a top predator, thus avoiding accumulation of heavy metals such as mercury.[citation needed]

References

  1. ^ "Trachurus symmetricus". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=168586. Retrieved 3 July 2008.
  2. ^ Reed, David L.; Carpenter, Kent E. & deGravelle, Martin J. (2002). "Molecular systematics of the Jacks (Perciformes: Carangidae) based on mitochondrial cytochrome b sequences using parsimony, likelihood, and Bayesian approaches". Molecular Phylogenetics and Evolution (USA: Elsevier Science) 23 (3): 513–524. doi:10.1016/S1055-7903(02)00036-2. PMID 12099802.
  3. ^ Zhu, Shi-Hua; Wen-Juan Zing, Ji-Xing Zou, Yin-Chung Yang & Xi-Quan Shen (2007). "Molecular phylogenetic relationship of Carangidae based on the sequences of complete mitochondrial cytochrome b gene". Acta Zoologica Sinica 53 (4): 641–650. http://www.actazool.org/paperdetail.asp?id=6630&volume=53&number=4&bgpage=641&=endpage650&year=2007&month=8. Retrieved 2008-01-03.
  4. ^ Ayres, William O. (1855). "Descriptions of new species of Californian fishes". Proceedings of the California Academy of Sciences (Series 1) 1 (1): 23–77.
  5. ^ a b Walford, L. A.; G. S. Myers (1944). "A new species of carangid fish from the northeastern Pacific". Copeia (Copeia, Vol. 1944, No. 1) 1944 (1): 44–46. doi:10.2307/1438246. JSTOR 1438246.
  6. ^ Poulin, E.; L. Cardenas, C.E. Hernandez, I. Kornfield & F. P.Ojeda (2004). "Resolution of the taxonomic status of Chilean and Californian jack mackerels using mitochondrial DNA sequence". Journal of Fish Biology (The Fisheries Society of the British Isles) 65 (4): 1160–1164. doi:10.1111/j.0022-1112.2004.00514.x.
  7. ^ a b c Froese, Rainer, and Daniel Pauly, eds. (2008). "Trachurus symmetricus" in FishBase. August 2008 version.
  8. ^ a b c d Fischer, W.; F. Krupp, W. Schneider, C. Sommer, K. Carpenter & V.H. Niem (1995). Guía FAO para la identificación de especies para los fines de la pesca. Pacífico centro-oriental. Volumen III. Vertebrados - Parte 2. Rome: FAO. p. 985. ISBN 92-5-303675-3. http://www.fao.org/fishery/sidp/3,1/en#Ecp.
  9. ^ Blunt C.E. Jr. (1969) "The jack mackerel (Trachurus symmetricus) resource of the eastern North Pacific" Calif. Alar. Ees. Comm., 13 : 16-52.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!