Overview

Brief Summary

The Florida pompano (Trachinotus carolinus) is one of 20 species in the marine jack family (Carangidae) and considered excellent eating. Though as larvae they often live offshore, adults inhabit coastal areas along the western coast of the Atlantic Ocean from Massachusetts to Brazil, especially in turbid waters; they are usually absent from the Bahamas and other clear-water regions. This species prefers water temperatures between 17-32 degrees Centigrade, and migrates south into warmer waters and in the gulf of Mexico in winter months. Pompanos are rapidly growing fish. They are typically caught at sizes of 2-5 pound but can reach 9 pounds. Adults form fast-swimming schools that inhabit surf flats, grazing on small bottom-dwelling invertebrates, including bivalves, copepods, crab larvae and invertebrate eggs. Caught commercially in all southern states, T. carolinus is an especially important commercial species in Florida, where it makes up to 90% of commercial harvests, and fetches one of the highest prices of any fish. It is also a popular recreational fishery. Florida pompano is seasonally abundant, but The Florida Fish and Wildlife Conservation Commission (FWC) considers populations on the Atlantic coast of Florida overfished and of high conservation concern, and populations on the Gulf of Mexico coast of Florida of moderate concern. Because it is fast growing and a good food fish, Florida pompano is recognized as having great potential as an aquaculture species; research on culturing techniques and water recycling methods to increase production of warm-water fish are underway.

(Cufone and Ostdahl 2005; Froese and Pauly 2000; Mote Marine Laboratories; Smithsonian Marine Station at Fort Pierce; Wikipedia 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Adults occur in coastal waters, commonly entering bays and estuaries. Juveniles found in sandy beaches exposed to wave action (Ref. 5217). Adults are absent from insular areas with coralline habitats (Ref. 5217). They generally form small to large schools. They feed on mollusks, crustaceans and other invertebrates and small fish. Excellent food fish (Ref. 9626). Highest priced marine food fish in the USA (Ref. 171). Have been reared in captivity (Ref. 35420).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: from Massachusetts, USA and throughout the Gulf of Mexico, Central and South American coasts, scattered localities in West Indies, southward to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA through the Gulf of Mexico and scattered localities in the West Indies (Ref. 26938) to Brazil. Also found in Argentina (Ref. 44847). Absent from clear waters of Bahamas and similar islands (Ref. 7251).
  • Berry, F.H. and W.F. Smith-Vaniz 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). volume 1. FAO, Rome. [var. pag.]. (Ref. 3277)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Though uncommon north of Chesapeake Bay, Florida pompano occur in nearshore coastal waters from approximately Cape Cod, Massachusetts south to Brazil, including the Gulf of Mexico, Central America, and patchily in some parts of the West Indies (Gilbert 1986; Robins and Ray 1986). It is generally absent from clear-water, tropical regions such as the Bahamas. Florida pompano are distributed throughout the India River Lagoon with major concentrations occurring along east central Florida from Cape Canaveral south to Palm Beach. On the west coast of Florida, pompano are common from approximately Ft. Meyers south to the Florida Keys.
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 640 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

64.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 3,760 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum recorded length for a Florida pompano was 63.5 cm (25 inches) TL, and 3.6 kg (7.9 pounds) (Fields, 1962; Robbins and Ray 1986), though most are harvested below 1.8 kg (4 pounds) (Buckow 1965). Finucane (1969) estimated a monthly growth rate of approximately 22 mm (0.86 inches) for post-juveniles, while Bellinger and Avault (1970) estimated an average adult growth rate of 36 mm (1.4 inches) per month. Females tend to grow faster and reach larger sizes than do males (Muller et al. 2002). Berry and Iversen (1967) estimated that most Florida pompano live 3 -4 years, with some living over 7 years.
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Florida pompano are similar in body form to 2 related species: the permit (Trachinotus falcatus) and the palometa (T. goodie).The permit has fewer soft rays on both the dorsal and anal fins. The dorsal fin typically has 17-21 (usually 17 or 18) soft rays, while the anal fin typically has 16-19 (usually 17-18) rays. Small permit under 9 cm (3.5 inches) total length (TL) also have teeth on the tongue. Additionally, permit grow considerably larger than Florida pompano and can reach as much as 20 - 50 pounds. The palometa also has fewer dorsal and anal rays, typically 19 - 20 dorsal rays and 16 - 18 anal rays. It also has 4 dark narrow bars on the upper body. Further, the anterior anal and dorsal soft rays are elongated in subadults and adults, and can extend as far as the caudal peduncle.
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 70 m (Ref. 9626)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 167 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 0 - 33
  Temperature range (°C): 13.162 - 25.874
  Nitrate (umol/L): 0.289 - 1.778
  Salinity (PPS): 32.865 - 36.162
  Oxygen (ml/l): 4.671 - 6.156
  Phosphate (umol/l): 0.092 - 0.407
  Silicate (umol/l): 0.756 - 2.170

Graphical representation

Depth range (m): 0 - 33

Temperature range (°C): 13.162 - 25.874

Nitrate (umol/L): 0.289 - 1.778

Salinity (PPS): 32.865 - 36.162

Oxygen (ml/l): 4.671 - 6.156

Phosphate (umol/l): 0.092 - 0.407

Silicate (umol/l): 0.756 - 2.170
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 70m.
Recorded at 70 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in coastal waters, commonly entering bays and estuaries. Juveniles found in sandy beaches exposed to wave action (Ref. 5217). Absent from insular areas with coralline habitats (Ref. 5217). Generally forms small to large schools. Feeds onmollusks, crustaceans and other invertebrates and small fish (Ref. 26338).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pompano are primarily bottom feeders that opportunistically "graze" preferred species. Well developed pharyngeal plates are present, and indicate that hard-shelled organisms such as crabs and mollusks are important in the diet. Young pompano apparently feed on organisms that are most available; but become more selective in their prey choices as they age (Finucane 1969; Gilbert 1986). Juveniles ranging in size from 13.5 - 80.5 mm (0.53 - 3.2 inches) SL consume amphipods, bivalves, crab larvae, copepods, isopods and invertebrate eggs (Fields 1962). Finucane (1969) reported pompano in Tampa Bay, Florida, ranging in size from 50 - 100 mm (1.9 - 3.9 inches), ate crustaceans and mollusks, while those from 110 - 138 mm (4.3 - 5.4 inches) ate Donax sp., particularly Donax variabilis (variable coquina).Limited data are available for food habits of adult Florida pompano. However, Finucane (1969) sampled gut contents from 19 adult pompanos taken in the Tampa Bay area and found that all fishes sampled fed exclusively on the scorched mussel, Brachidontes exustus, which commonly lives attached to rocks in the deeper portion of Tamp Bay. However, adult pompano caught in the Gulf of Mexico, in the vicinity of oil rigs, fed primarily on penaeid shrimp. Competitors: Florida pompano are preyed upon by birds, particularly brown pelicans, and other birds that utilize beach areas as feeding grounds (Gilbert 1986).Parasites of Florida pompano include 2 genera of isopods. Ione spp. attach to the mouth and gill area, while Aegathoa spp. Attach to the body and fins. A parasitic brachyuran, Argulus sp. was also found on the skin. Mature and immature nematodes were located inside the body cavity and encysted in the viscera (Finucane 1969). Habitats: Trachinotus carolinus larvae spend their first month of life in offshore waters, migrating nearshore upon reaching approximately 10 - 30 mm (0.39 - 1.18 inches) standard length (SL). In Florida, migration typically occurs from mid-April through mid-May (Fields 1962). This early group of larvae is followed at approximately 1 month intervals by later cohorts until October or, sometimes, December. Juvenile pompano migrate to deeper waters upon reaching 60 - 70 mm (2.4 - 2.8 inches) TL, beginning in mid-July and continuing until winter water temperatures drop below 19ºC, at which time, nearly all juveniles have moved to deeper waters (Gilbert 1986). Low energy surf zones along beaches are the preferred nursery habitat for larvae and young juveniles (Field 1962; Gilbert 1986). Typical habitats for older juveniles as well as adult Trachinotus carolinus are sloping beaches with sandy or muddy substrata, estuaries and shallow bays, piers, and sand flats (Fields 1962; Gilbert 1986).Maximum depth is approximately 60 to 75m (197 - 246 feet) (Field 1962).
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Hurleytrematoides Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Though it is estimated that stocks of Florida pompano are overfished (Muller et al. 2002), pompano can be abundant in east central Florida, especially seasonally. It generally forms small to large schools.
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Males reach sexual maturity at approximately age 1, when they attain 35.6 cm (14 inches) TL. Females reach maturity between the ages of 2-3, when they reach 30 - 39.9 cm (11.8 - 15.7 inches) TL (Muller et al. 2002). The spawning season for Florida pompano is protracted, lasting from spring through late fall, with peaks from April - June and September - October (Gilbert 1986). It is generally assumed that spawning occurs offshore, based on evidence from larval collections and collection of spent fishes (Gilbert 1986, Muller 2002). Finucane (1969) collected small larvae measuring 3.0 - 4.5 mm (0.12 - 0.18 inches) in waters 24 km (15 miles) offshore in the Gulf of Mexico. Trachinotus carolinus apparently does not spawn north of Virginia (Gilbert 1986). Fecundity estimates range from 133,000 - 800,000 eggs per season, depending on body size (Finucane 1969, 1970; Moe et al. 1968).
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachinotus carolinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TAGTATTTGGTGCTTGAGCCGGAATAGTAGGTACAGCTTTAAGCCTACTTATCCGAGCGGAGCTTAGTCAACCTGGCGCCCTCCTAGGAGATGACCAAATTTACAATGTAATCGTTACAGCTCATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTTATCCCACTAATGATTGGAGCCCCTGATATAGCATTCCCTCGAATAAATAACATGAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTTCTTCTCGCCTCCTCTGGGGTAGAAGCAGGTGCCGGAACCGGTTGAACAGTCTACCCTCCCTTAGCTGGTAATCTTGCCCATGCAGGAGCATCTGTTGATTTAACCATTTTCTCTCTTCATTTAGCTGGTATTTCATCAATTCTAGGGGCTATTAACTTCATCACAACAGTAATTAACATAAAACCTCATGCTGTCTCTATATATCAAATCCCACTATTTGTCTGAGCCGTTCTAATCACAGCTGTCCTCCTGCTCCTCTCACTTCCCGTTTTAGCTGCCGGCATTACTATGCTTCTAACCGACCGAAACCTAAACACTGCCTTCTTTGACCCAGCTGGGGGTGGGGACCCAATCCTATACCAACACCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trachinotus carolinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums; price category: very high; price reliability: reliable: based on ex-vessel price for this species
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Nigrelli, R.F. 1959 Longevity of fishes in captivity, with special reference to those kept in the New York Aquarium. p. 212-230. In G.E.W. Wolstehnolmen and M. O'Connor (eds.) Ciba Foundation Colloquium on Ageing: the life span of animals. Vol. 5., Churchill, London. (Ref. 273)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fisheries Importance: Prized as one of the great food fishes in Florida waters, the dockside price for Florida pompano is typically among the highest per pound for any fish (Gilbert 1986). Florida pompano are caught commercially in all states from Virginia through Texas, but Florida accounts for more than 90% of the total harvest. The average commercial size for Florida pompano ranges from 27.9 - 33.0 cm (11 - 13 inches) in length (Muller et al. 2002). In Florida waters, most of the commercial catch is harvested along the west coast, from Charlotte County south through Monroe County, with the bulk of the harvest taken offshore from Lee and Collier Counties (Muller et al. 2002). On Florida's east coast, the bulk of the commercial catch is taken offshore between Brevard county and Palm Beach County. Some of the commercial catch is harvested from the Indian River and Banana Rivers (Muller et al. 2002; Gilbert 1986). Interestingly, harvests of pompano increased in Lee and Collier Counties after gill nets were banned from Florida waters in 1995; however it is believed that this increase in harvest resulted more from changes in gear types than to an increase in the pompano population (Muller et al. 2002). The commercial fishery for pompano shows a degree of seasonality. In northwest Florida, most landings are made in April, with secondary peaks from August through September. In the Tampa Bay area, the fishery is active year-round, with landings peaking from March - April, and July - November. In the Florida Keys, most landings occur from December through February. On Florida's east coast, the northeast fishery peaks in April, while in the vicinity of the Indian River Lagoon, the highest landings are recorded between November and May (Muller et al. 2002). Catch rates for pompano, when adjusted statistically for catch effort (number of trips, duration of trips, etc.) have declined gradually on the east coast of Florida from 1985 - 2000, with an average of 54% fewer trips after 1995 on the Atlantic coast. On the west coast, catch rates were stable between 1985 and 1992, and then increased. However, after 1995, commercial trips declined an average of 65% (Muller et al. 2002). RECREATIONAL LANDINGS DATA: Trachinotus carolinus is also an important recreational species, with landings by sport fishers increasing since 1989 (Muller et al. 2002). Approximately 58% of Florida's recreational harvest of pompano is made on the east coast; with nearly 59% of the east coast catch taken from shore-based sites such as jetties and piers, and 41% harvested using boats. The bulk of the east coast harvest is taken during winter and early spring. However, recreational landings in the Gulf of Mexico show no such pattern (Muller et al. 2002).
  • Armitage, T.M. and W.S. Alevizon. 1980. The diet of the Florida pompano (Trachinotus carolinus) along the east coast of central Florida. Florida Scientist 43(1):19-22.
  • Bellinger, J.W. and J.W. Avault, Jr. 1970. Seasonal occurrence, growth, and length-weight relationship of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 99(2):353-358.
  • Bellinger, J.W. and J.W. Avault, Jr. 1971. Food habits of juvenile pompano, Trachinotus carolinus, in Louisiana. Trans. Am. Fish. Soc. 100(3):486-494.
  • Berry, F.H. and E.S. Iversen. 1967. Pompano: biology, fisheries and farming potential. Proc. Gulf. Carrib. Fish. Inst. 19:116-128.
  • Berry, F.H. and W.F. Smith-Vaniz, 1978 Carangidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 1. FAO, Rome. [var. pag.]
  • Buckow, E.C. 1965. Pompano, Trachinotus carolinus,: angling methods. Pages 764 - 765, in: A.J. McClane, ed. McLane's new standard fishing encyclopedia. Holt, Renehard, and Winston. 156 pp.
  • Fields, H.M. 1962. Pompanos (Trachinotus sp.) of South Atlantic coast of the United States. U.S. Fish and Wildlife Service Fisheries Bulletin. 62:189-222.
  • Finucane, J.H. 1969. Ecology of the pompano (Trachinotus carolinus) and the permit (T. falcatus) in Florida. Trans Am. Fish. Soc. 98(3):478-486.
  • Finucane, J.H. 1970. Progress in pompano mariculture in the United States. FirstAnnual Workshop, World Mariculture Society. Pp. 69-72.
  • Gilbert, C. 1986. Species profiles: life histories and environmental requirements ofcoastal fishes and invertebrates (south Florida): Florida pompano. U.S. Fishand Wildlife Service Biological Report 82(11.42). U.S. Army Corps ofEngineers, TR-EL-82-4. 14 pp.
  • Gunter, G. and G.H. Hall. 1963. Biological investigations of the St. Lucie Estuary(Florida) in connection with Lake Okeechobee discharge through the St. Lucie Canal. Gulf Coast Res. Lab. Gulf. Res. Rep. 1(5):189-307.
  • International Game Fish Association, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  • Johnson, G.D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4. Carangidae through Ephippidae. US Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-78/12.
  • Moe, M.A., Jr. , R.A. Lewis, and R.M. Ingle. 1968. Pompano mariculture: preliminary data and basic considerations. Fla. Board Conserv. Mar. Lab. Tech. Ser. Ser. 55. 65 pp.
  • Muller, R.G., K.Tisdel, and M.D. Murphy. 2002. The 2002 update of the stock assessment of Florida Pompano (Trachinotus carolinus). Florida Fish and Wildlife Conservation Commission, Florida Marine Research Institute, St. Petersburg, FL. 45 pp.
  • Perret, W.S., W.R. Latipie, J.F. Pollard, W.R. Mock, B.G. Adkins, W.J. Gaidry,and C.J. White. 1971. Fishes and invertebrates collected in trawl and seine samples in Louisiana estuaries. Pages 39-105 in: Louisiana Wildlife and Fisheries Commission Cooperative Gulf of Mexico Estuarine Inventory and Study. Louisiana Department of Wildlife and Fisheries, Baton Rouge. 175 pp.
  • Robins, C.R. and G.C. Ray, 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Florida pompano

The Florida pompano (Trachinotus carolinus[1]) is a species of marine fish in the Trachinotus (pompano) genus of the Carangidae family. It has a compressed body and short snout; coloration varies from blue-greenish silver on the dorsal areas and silver to yellow on the body and fins. It can be found along the western coast of the Atlantic Ocean, depending on the season, and is popular for both sport and commercial fishing. Most Florida pompano caught weigh less than 3 lb (1.4 kg) and are less than 17 in (43 cm) long, though the largest individuals weigh 8–9 lb (3.6–4.1 kg) and reach lengths up to 26 in (66 cm).

Because it is fast-growing and desirable for food, the pompano is one of the many fish that is currently being farmed through aquaculture.

The Florida city of Pompano Beach is named after the Florida pompano.


Description[edit]

The different kinds of pompano include African, Cayenne, Florida and Irish. The Florida pompano (T. carolinus) is part of the jack family. It is very similar to the permit (Trachinotus falcatus). It has a deeply forked tail and is blue-greenish silver with yellow on the throat, belly, and pelvic and anal fins. The first dorsal fins are low, with about six separate spines. The first spine may be reabsorbed in a larger fish. The second lobes on the dorsal and anal fins have a lower anterior.[2] There are 20-24 anal fin rays. It is a compressed fish with a deep body and a blunt snout.

Trachinotus carolinus, Rio Grande do Sul, Brazil


Size[edit]

Pompano WL.png

Juvenile pompano grow between 0.8 and 1.9 in (20 and 48 mm) per month, depending on the population. Pompano grow quickly and attain a length of about 12 in (30 cm) and a weight of about 1 lb (0.45 kg) after the first year. The relationship between total length (L, in inches) and total weight (W, in pounds) for nearly all fish can be expressed by an equation of the form: W = cL^b\!\,

Invariably, b is close to 3.0 for all species, and c is a constant that varies among species.[3] A weight-length relationship was determined for a sample of 1,984 Florida pompano collected along the Gulf Coast of Florida between 2000 and 2002.[4] The fish sampled ranged in length from 79-481 mm (3.16-19.24 in). For this sample of Florida pompano, b = 2.9342 and c = 0.00076.

This relationship predicts that a 12-inch (300 mm) pompano will weigh about a pound. Most are less than three pounds when caught, though the largest pompano recorded have weighed 8-9 lb and were 23-25 in long.

Lifespan[edit]

The Florida pompano usually survives for only about three to four years,[5] although individuals as old as 6-7 yr have been caught.[4]

Range and habitat[edit]

The adult Florida pompano is typically found in more saline areas and relatively warm waters (70-89°F), so it migrates northward in the summer, and toward the south in the fall.[5] Despite its name, the range of the Florida pompano extends from Massachusetts to Brazil, but it is more common in areas near Florida. During the summer, it can be found near Sebastian, Cape Hatteras, and the Gulf of Mexico. It is more common near oil rigs, Palm Beach, and Hobe Sound during the winter. It can also be found near the Virgin Islands year round.

Its habitat is surf flats, and it tends to stay away from clear water regions, such as the Bahamas.[6] Pompanos are very fast swimmers and live in schools. They are bottom feeders. They have very short teeth and feed on zoobenthos and small clams.

Ecology[edit]

Food[edit]

The pompano is a popular food fish. Chefs like it because the fillets are of even thickness, which aids in cooking. A popular dish created in New Orleans, called “pompano en papillote,” is wrapped in parchment paper with a white sauce of wine, shrimp, and crabmeat, and then steamed.[7]

The pompano’s flesh is oily and looks white and opaque. Its diet yields a rich but mild flavor. Fresh fillets can cost $17 or more.[8] Demand has encouraged the use of aquaculture to increase supply.

Aquaculture[edit]

The Florida pompano is a popular choice for aquaculture because it is such a popular food and sport fish and is in high demand, and at the same time it has a fast growth rate, high dockside prices,[9] and a tolerance for low-salinity waters.[9] The typical market size of farm-raised pompano is 1 to 1.5 lb (0.45 to 0.68 kg).[10]


Fishing[edit]

The pompano supports an important commercial and recreational fishery. Florida pompano are commercially fished in all states on the East Coast from Virginia to Texas, with Florida producing over 90% of the annual harvest. Harvesting occurs mostly along Florida's western coast, with some harvesting on the eastern coast and in the Banana and Indian Rivers. Between 1994 and 2006, it commanded dockside prices of more than $3 per pound of whole fish weight.[10]

Individually, Florida pompano are caught on light jigs and popping corks. They are very active on the line, testing light tackle beyond what their weight would suggest.[7] They bite near oil rigs in the winter.

From 1997-2000, the fishing mortality rates increased sharply. However, an extensive study by the Florida Fish and Wildlife Commission concluded, as of 2005, the population of Florida pompano was healthy and the fishery was sustainable with current practices.[4][7]

See also[edit]

List of fish species in Florida


References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Trachinotus carolinus" in FishBase. April 2006 version.
  2. ^ Smith, C. Lavett, National Audubon Society Field Guide to Tropical Marine Fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Chanticleer Press, 1997, ISBN 0-679-44601-X, color plate 268, p. 490
  3. ^ R. O. Anderson and R. M. Neumann, Length, Weight, and Associated Structural Indices, in Fisheries Techniques, second edition, B.E. Murphy and D.W. Willis, eds., American Fisheries Society, 1996.
  4. ^ a b c Murphy, M.D., Muller, R.G., Guindon, K. A stock assessment for pompano, Trachinotus carolinus, in Florida waters through 2005. Report to the Florida Fish and Wildlife Conservation Commission, Division of Marine Fisheries Management. In-house report 2008-004, 2008.
  5. ^ a b ESPN page on Florida pompano
  6. ^ Smithsonian Marine Station page on Florida pompano
  7. ^ a b c Ristori, Al. The Saltwater Fish Identifier. New York: Mallard Press, 1992, ISBN 0-7924-5575-4, pp. 44
  8. ^ http://www.floridasportsman.com/xtra/pompano_plate_xtra_1002/index.html
  9. ^ a b rch%20and%20Development MOTE Marine Laboratory aquaculture of Florida pompano
  10. ^ a b Southern Regional Aquacultural Center (Texas A&M) Species Profile on Florida pompano 2007
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!