Overview

Comprehensive Description

Biology

Inhabits rocky and sandy pools and runs of small to large rivers. Common in clear, warm streams. Voracious minnow with pike-like habits (Ref. 5723). Small pikeminnows (less than or equal to 7 cm SL) are found in shallow water with cover and lower velocities. The microhabitat use of these juveniles is controlled by the presence of large pikeminnows which connotes intraspecific predation. The microhabitat shift is observed to be significantly influenced by the presence rather than the number of large pikeminnows in the area (Ref. 55069).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Sacramento-San Joaquin, Pajaro-Salinas, Russian River, upper Pit River, and Clear Lake drainages, California (Lee et al. 1980, Page and Burr 1991). Recently introduced in Eel River, California (Carney and Page 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Sacramento-San Joaquin, Pajaro-Salinas, Russian, Clear Lake and upper Pit River drainages in California, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

140 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 9 years (Ref. 72486)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
  • Taft, A.C. and G.I. Murphy 1950 Life history of the Sacramento squawfish (Atychocheilus grandis). Calif. Fish and Game 36:147-164. (Ref. 72486)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Ptychocheilus harfordi
Catalog Number: USNM 27246
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Sacremento, R., Cal., California, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Larger and clearer intermittent and permanent streams (with summer temperatures in excess of 15 C) (Lee et al. 1980). Rocky and sandy pools and runs of small to large rivers; common in clear, warm streams (Page and Burr 1991). Usually in undisturbed habitat; rare or absent where introduced predatory fishes plentiful. Usually spawns in streams in gravel riffles where water temperatures exceed 14 C. Populations in reservoirs may spawn near shore on gravel areas (Moyle 1976). Eggs adhere to rocks and gravel.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ptychocheilus grandis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTGTATTTGGTGCCTGAGCAGGAATAGTGGGAACCGCTTTAAGCCTTCTTATTCGGGCCGAACTTAGCCAACCCGGATCACTCCTAGGTGATGACCAGATTTATAATGTTATTGTTACCGCCCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCAATTCTTATTGGAGGATTCGGAAATTGACTCGTCCCCCTAATAATTGGCGCACCTGATATAGCATTCCCCCGAATGAATAACATAAGCTTCTGACTTCTCCCCCCATCATTCCTTCTTCTATTAGCCTCTTCTGGTGTTGAGGCCGGAGCTGGGACAGGGTGAACAGTATACCCCCCACTTGCAGGTAACCTGGCCCACGCGGGGGCATCCGTAGATCTAACAATCTTCTCACTACATCTGGCAGGTGTCTCATCAATCTTAGGGGCAGTAAACTTTATTACCACAATTATTAATATAAAACCCCCAGCCATCTCCCAATACCAGACACCTCTCTTCGTATGGGCCGTACTTGTAACAGCCGTTCTTCTTCTGTTATCACTACCAGTCCTGGCTGCCGGAATCACAATGCTTCTTACAGATCGAAATCTTAACACCACATTCTTTGACCCAGCGGGAGGGGGAGATCCAATTTTATATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ptychocheilus grandis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Formerly more abundant than at present.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sacramento pikeminnow

The Sacramento pikeminnow (also known as Sacramento squawfish) is a large cyprinid fish of California. It is native to the Los Angeles River, Sacramento-San Joaquin, Pajaro-Salinas, Russian River, Clear Lake and upper Pit River river basins.

The species has been introduced into the Salt River, where it is considered an invasive species.[1]

References[edit]

  1. ^ "Salt River Basin Assessment Report". Coastal Watershed Planning and Assessment Program. California Department of Fish and Game. May 2005. Retrieved October 20, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!