Overview

Comprehensive Description

Biology

Inhabit coastal to outer reefs. Habitats from silty lagoons to pristine outer reef walls (Ref. 48637). Occur in shallow lagoon and seaward reefs. Solitary and territorial. Feed on a wide variety of invertebrates. Also taken by drive-in nets (Ref. 9770). Oviparous (Ref. 205). Monogamous (Ref. 52884).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: East Africa south to the Chalumna River, South Africa (Ref. 11228) and east to Samoa, north to southern Japan, south to Lord Howe Island. Replaced by closely related Sufflamen albicaudatus in the Red Sea (Ref. 37816).
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Samoa, north to southern Japan and Ogasawara Islands, south to Lord Howe Island and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 26 - 28; Analspines: 0; Analsoft rays: 23 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 30573))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Juveniles dark brown above, white below (Ref. 1602). Adult variable in color; the bar running through the pectoral base can either be yellow or black, and some individuals may be largely yellowish posteriorly (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 5 - 29.5
  Temperature range (°C): 26.525 - 26.525
  Nitrate (umol/L): 0.732 - 0.732
  Salinity (PPS): 35.095 - 35.095
  Oxygen (ml/l): 4.572 - 4.572
  Phosphate (umol/l): 0.121 - 0.121
  Silicate (umol/l): 0.869 - 0.869

Graphical representation

Depth range (m): 5 - 29.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in shallow lagoon and seaward reefs. Solitary and territorial. Feeds on a wide variety of invertebrates (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male defends a defined territory, within which a female resides. On the day prior to spawning, female pushes her snout into the sandy bottom repeatedly and removes small stones and pieces of coral at several sites. Adhesive eggs are deposited on the sandy bottoms or in a small cavity of the reef covered with sand. Female fans the eggs and defends the nest, while male patrols around female.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sufflamen chrysopterum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTAAGTCTATTAATCCGAGCGGAACTGAGCCAACCCGGCGCTCTCTTGGGCGATGACCAAATTTATAACGTCATCGTTACAGCACATGCTTTCGTTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGTTTTGGAAACTGGTTAATTCCTCTAATAATTGGAGCCCCTGACATAGCATTTCCCCGGATAAACAACATGAGCTTTTGACTCCTACCTCCCTCCCTCCTACTACTTCTTGCCTCCTCAAGCGTAGAAGCCGGAGCCGGGACTGGGTGAACCGTCTATCCCCCTCTCGCAGGTAACCTGGCCCACGCAGGGGCCTCTGTCGACCTTACCATCTTCTCTCTTCACCTGGCAGGTGTTTCATCCATCCTAGGGGCAATTAATTTTATTACAACAATTATTAACATAAAACCTCCCGCCATCTCCCAATATCAAACACCGTTATTTGTTTGAGCAGTCCTAATCACAGCAGTTCTCCTGCTCCTATCCCTCCCGGTTTTAGCTGCCGGAATTACAATGCTTCTCACGGACCGAAACCTTAATACCACATTTTTTGACCCTGCCGGAGGAGGAGACCCTATTCTCTATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sufflamen chrysopterum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Halfmoon triggerfish

The Halfmoon triggerfish, Sufflamen chrysopterum, is a triggerfish of the tropical Indo-West Pacific area.

The Halfmoon triggerfish lives around seaward reefs and shallow lagoons. It is solitary and can often be seen swimming around coral looking for small animals, like crustaceans and worms, on which it feeds.

The Halfmoon picassofish species is often also named Halfmoon triggerfish.

The Halfmoon triggerfish is a solitary fish.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!