Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Zeus faber ZBK Linnaeus, 1758

Sea of Marmara : 9300-177 (6 spc.), 23.04.1932 ; 9300-681 (1 spa), 11.02.1995 , western waters of Imrah Island , trawl , 51 m, L. Eryilmaz . Aegean Sea : 9300-379 (1 spc.), 24.01.1969 , Goekova Bay , M. Demir ; 9300-528 (2 spc.), 14.08.1989 , Goekova Bay , trawl , 70 m, N. Meriç ; 9300-176 (1 spc.), 06.08.1989 , Guelluek Bay , trawl , 40 m, N. Meriç ; 9300-178 (3 spc.), 07.08.1989 , Guelluek Bay , trawl , 85 m, N. Meriç . Mediterranean Sea : 9300-175 (2 spc.), August 1968 , M. Demir ; 9300-168 (1 spa), August 1968 , M. Demir ; 9300- 179 (20 spa), 20.05.1967 , Iskenderun Bay , trawl , 60 m, M. Demir ; 9300-796 (2 spc.), October 2002 , Iskenderun Bay , trawl , C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 41-41, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in areas close to the sea bed (Ref. 6390). Generally solitary. Feeds mainly on schooling bony fishes, occasionally on cephalopods and crustaceans (Ref. 27121). Reproduction takes place at the end of winter and at the start of spring in the northeastern Atlantic, earlier in the Mediterranean. Eggs are pelagic, maturity reached at 4 years (Ref. 36731). Sold fresh (Ref. 9563) and frozen (Ref. 9988). Can be steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988). The flesh is excellent but is utilized little in West Africa (Ref. 5377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Body tall and laterally compressed like an oval plate. Between 30-70 cm in length. Eight to ten strong dorsal fin rays. Golden brown with dappled markings with a striking brown spot in middle of body. Large, very protractile mouth containing small conical teeth in jaws. Golden green-grey or silvery bronze.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Worldwide in distribution. Eastern Atlantic: Norway to South Africa, also the Mediterranean and Black Sea. Western Pacific: Japan, Korea, Australia and New Zealand. Also known from the Indian Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Baltic Sea, North Sea, Mediterranean Sea, Black Sea, eastern Atlantic; Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 11; Dorsal soft rays (total): 22 - 24; Analspines: 4; Analsoft rays: 20 - 23
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

90.0 cm TL (male/unsexed; (Ref. 6953)); max. published weight: 8,000 g (Ref. 35388); max. reported age: 12 years (Ref. 5377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Generally solitary. Feeds on fish (esp. schooling and demersal species), cephalopods, and crustaceans (Ref. 5213). Sold fresh in Australia and fetches a high market price (Ref. 9563), also marketed frozen (Ref. 9988). Can be steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gill rakers rudimentary. Minute scales present. Highly compressed body (Ref. 4253). Large dark spot, surrounded by a light ring on each side of the body (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 35388); brackish; marine; depth range 5 - 400 m (Ref. 9563), usually 50 - 150 m (Ref. 4968)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10621 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5899 samples.

Environmental ranges
  Depth range (m): -9 - 460
  Temperature range (°C): 6.433 - 22.136
  Nitrate (umol/L): 0.220 - 23.734
  Salinity (PPS): 34.029 - 38.739
  Oxygen (ml/l): 1.811 - 6.444
  Phosphate (umol/l): 0.094 - 1.817
  Silicate (umol/l): 0.677 - 38.833

Graphical representation

Depth range (m): -9 - 460

Temperature range (°C): 6.433 - 22.136

Nitrate (umol/L): 0.220 - 23.734

Salinity (PPS): 34.029 - 38.739

Oxygen (ml/l): 1.811 - 6.444

Phosphate (umol/l): 0.094 - 1.817

Silicate (umol/l): 0.677 - 38.833
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Midwater or near seabed at moderate depth, down to 400 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 400m.
From 5 to 400 meters.

Habitat: benthopelagic. Generally solitary. Feeds on fish (esp. schooling and demersal species), cephalopods, and crustaceans (Ref. 5213). Sold fresh in Australia and fetches a high market price (Ref. 9563), also marketed frozen (Ref. 9988). Can be steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits sandy and muddly areas in the deep. Found in areas close to the sea bed (Ref. 6390). Generally solitary. Feeds mainly on schooling bony fishes, occasionally on cephalopods and crustaceans (Ref. 27121).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

No studies of their reproductive development or early life history have been undertaken in Australia (Ref. 6390). Pelagic eggs (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Zeus faber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 53
Specimens with Barcodes: 82
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Zeus faber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTTTATTTAGTATTCGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTTCTTATTCGAGCTGAACTTAGTCAACCAGGGGCCCTCCTTGGAGAC---GATCAAATTTATAATGTTATCGTCACAGCTCACGCTTTTGTTATAATCTTTTTTATAGTTATACCAATCATAATTGGGGGCTTTGGGAACTGACTAATCCCACTTATAATCGGGGCCCCTGACATAGCCTTCCCCCGCATAAATAATATAAGCTTTTGACTCCTCCCCCCCTCCTTTTTACTTCTGCTCGCCTCTTCGGGAGTTGAAGCCGGAGCTGGGACAGGATGAACAGTCTACCCCCCTTTAGCAGGCAATCTAGCCCATGCCGGGGCCTCCGTAGATCTAACTATTTTTTCCCTCCACTTAGCAGGGATTTCATCTATCTTGGGCGCAATTAATTTTATTACCACCATTGTTAACATAAAACCCCCTGCCATTTCACAATACCAGACCCCCTTATTTGTGTGGTCAGTCCTGATTACAGCAGTCCTACTGCTTTTATCACTACCAGTACTAGCGGCTGGAATTACAATACTTCTCACTGACCGAAACTTAAACACCTCTTTCTTTGATCCTGCAGGCGGAGGAGACCCTATTTTATACCAACACCTATTTTGATTCTTCGGTCACCCCGAAGTCTATATTTTAATTCTTCCAGGCTTTGGAATAATCTCACATATTGTCGCCTACTACTCGGGGAAAAAAGAACCTTTTGGCTACATGGGCATGGTCTGAGCCATGATAGCAATTGGGTTACTTGGATTTATTGTATGGGCCCACCACATATTTACAGTAGGAATGGACGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

John Dory

This article is about the type of fish. For the folk song of the same name, see John Dory (song).

John Dory, also known as St Pierre or Peter's Fish, refers to fish of the genus Zeus, especially Zeus faber, of widespread distribution. It is an edible benthic coastal marine fish with a laterally compressed olive-yellow body which has a large dark spot, and long spines on the dorsal fin. The dark spot is used to flash an 'evil eye' if danger approaches. Its large eyes at the front of the head provide it with binocular vision and depth perception, which are important for predators. The John Dory’s eye spot on the side of its body also confuses prey, which are scooped up in its big mouth.[2][3]

In New Zealand, Māori know it as kuparu, and on the East Coast of the North Island, they gave some to Captain James Cook on his first voyage to New Zealand in 1769. Several casks of them were pickled.[2]

Name[edit]

Various explanations are given of the origin of the name. It may be an arbitrary or jocular variation of dory (itself from the French dorée, gilded), or perhaps an allusion to John Dory, the hero of an old ballad. Others suggest that "John" derives from the French jaune, yellow. The novel An Antarctic Mystery by Jules Verne gives another account, which has some popularity but is probably fanciful: "The legendary etymology of this piscatorial designation is Janitore, the 'door-keeper,' in allusion to St. Peter, who brought a fish said to be of that species, to Jesus at his command." (St. Peter is said to be keeper of the gates of Heaven, in Spanish it is known as "gallo" hence "door-keeper".) Considering that the other known names for the John Dory are the "St. Pierre", or "Peter's Fish", as referenced above, this seems the most likely etymological origin,[contradiction] and may also explain why dories were often referred to as Peter Boats (Saint Peter being the patron saint of fishermen).[4] A related legend says that the dark spot on the fish's flank is St. Peter's thumbprint.[5]

Morphology[edit]

John Dory.

The John Dory grows to a maximum size of 65 cm (2 ft) and 3 kg (7 lb) in weight. It has 10 long spines on its dorsal fin and 4 spines on its anal fin. It has microscopic, sharp scales that run around the body. The fish is an olive green color with a silvery white belly and has a dark spot on its side. Its eyes are near the top of its head. It has a flat, round body shape and is a poor swimmer.

Prey and predators[edit]

The John Dory usually gets its food by stalking it then extending its jaw forward in a tube like structure which provides suction to suck the fish in with some water. The water then flows out through the gills and the pre-maxilla bone, the only tooth bearing bone in this fish is used to grind it up. The John Dory is primarily a piscivore and eats a variety of fish, especially schooling fish, such as sardines. Occasionally they eat squid and cuttlefish.

Their predators are sharks, like the dusky shark, and large bony fish, and humans.

Habitat[edit]

John Dory are coastal fish, found on the coasts of Africa, South East Asia, New Zealand, Australia, the coasts of Japan, and on the coasts of Europe. They live near the seabed, living in depths from 5 metres (15 ft) to 360 metres (1200 ft). They are normally solitary.

Reproduction and lifespan[edit]

After they are 3 or 4 years of age they are usually ready to reproduce. This happens around the end of winter. They are substrate scatterers, which means that they release sperm and eggs into the water to fertilize. Typical lifespan is about 12 years in the wild.

References[edit]

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. Retrieved 2007-12-25. 
  2. ^ a b New Zealand Coastal Fish: John Dory.
  3. ^ Bray, Dianne. "John Dory, Zeus faber". Fishes of Australia. Retrieved 24 August 2014. 
  4. ^ see 1:Charlotte Mary Yonge, History of Christian names, Volume 1, pg. 359// 2: Abraham Smythe Palmer "Folk Etymology; Verbal Corruptions Or Words Perverted In Form Or Meaning pg. 196// 3.David Badham, Prose halieutics: or, Ancient and modern fish tattle/ 4: American Notes and Queries, Volume 3 pg. 129// and 5: Fraser's Magazine For Town And Country, January To June 1853
  5. ^ The legend is noticed in Stéphan Reebs, Fish Behavior in the Aquarium and in the Wild (Cornell 1991:36); Reebs notes that the fish does not occur in the Sea of Galilee, where Peter fished.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!