Overview

Brief Summary

Umbrina roncador (yellowfin croaker) is a nearshore fish that is found from Point Conception in California to Bahia Magdalena in Baja California, Mexico, as well as in the northern part of the Gulf of California (Radford and Walker 1992). Their nomenclature refers to their coloring and their place within the Sciaenidae (croaker) family, which is characterized by the unique drumming noises produced by fish in this family (Pondella et al. 2008). Some of the yellowfin croaker’s distinguishing characteristics are its short chin barbel and its distinctive yellow fins. The majority of the yellowfin croaker’s body is a silver shade with a blue tinge on its back (Skogsberg 1939). Yellowfin croaker grow at a faster rate until three years of age, around when they reach sexual maturity (Pondella et al. 2008) and their lifespan can be as much as 15 years. Female yellowfin croakers reach their adult size faster than the males (Miller et al. 2011) and their reproductive season usually occurs in the summer months (Pondella et al 2008).

References

Miller, E. F., C. T. Mitchell, D. J. Pondella, II, and S. Goldberg. 2011. Life History Parameters of Common Marine Fish Subject to Entrainment. California Energy Commission, PIER Energy-Related Environmental Research Program. CEC-500-2011-008.

Pondella, D. J., J.T. Froeschke, L.S. Wetmore, E. Miller, C.F. Valle, and L. Medeiros. 2008. Demographic Parameters of Yellowfin Croaker, Umbrina roncador (Perciformes: Sciaenidae), from the Southern California Bight. Pacific Science, 62(4): 555-568.

Radford, K.W. and H.J. Walker Jr. 1992. Eastern Pacific species of the genus Umbrina (Pisces: Sciaenidae) with a description of a new species. Fishery Bulletin, 90(3): 574-587.

Skogsberg, T. 1939. The Fishes of the Family Sciaenidae (Croakers) of California. Division of Fish and Game of California, Bureau of Marine Fisheries, Fish Bulletin, 54:54-56.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Maggie Berrigan, Keri Nakama, Jacob Valk

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found in shallow sandy areas, often in surf zones, bays and tidal sloughs. Feed on fishes, crustaceans, marine worms and bivalves (Ref. 9118) Often caught by surf fishers. Pelagic spawners (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: croaker (English), drum (English), berrugata (Espanol), verrugato (Espanol)
 
Umbrina roncador Jordan & Gilbert, 1882


Yellowfin croaker,     Yellow-fin drum


Body oblong, somewhat compressed, lower profile ~ horizontal; back strongly arched; head low, broad, conical; snout < eye; mouth ~ horizontal, under projecting snout; chin with 1 short, thick rigid barbel with a pore at its tip, and 2 pairs of pores beside its base; teeth in bands on each jaw, outer row on top jaw larger; 15-22 gill rakers; preopercle finely serrated; dorsal fin with a deep notch, X + I, 24-30, spines slender, second dorsal long base; anal small, II, 7 (rarely 6) rays, 2nd  spine thick, > ½ length of 1st  ray; pectoral short, not reaching tip of pelvic, 16-19 rays; tail edge straight to slightly concave the upper rays elongated; scales rough on head and body, smooth on fins; bases of soft dorsal and anal fins with scaly sheath; lateral line scales 51-54.



Bright silvery, bluish above; sides with oblique, undulating brown or olive lines following scale rows; fins yellow; inner side of gill cover blackish; lining of gut cavity dark.


Size: attains 55.6 cm.

Inhabits coastal areas, including sandy bays and harbours.

Depth: 1-45 m.

Point Conception, California to the NE Gulf of California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: Point Conception in California, USA to the Gulf of California; old records from as far north as San Francisco, California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from Point Conception, in southern California, to the tip of Baja California and in the northeastern Gulf of California. Historical records however have been reported from as far north as San Francisco, California (Chao, 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 45 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continental TEP endemic, Cortez province endemic, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Umbrina roncador can be found from Magdalena Bay in Baja California up to Point Conception in Southern California, as well as in the northern part of the Gulf of California (Radford and Walker 1992).

References:

Radford, K.W. and H.J. Walker Jr. 1992. Eastern Pacific species of the genus Umbrina (Pisces: Sciaenidae) with a description of a new species, Fishery Bulletin, 90(3): 574-587.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Maggie Berrigan, Keri Nakama, Jacob Valk

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 55.6 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Some of Umbrina roncador’s distinguishing characteristics are its short chin barbel and its distinctive yellow fins. The majority of the its body is a silver shade with a blue tinge on its back, with dark green streaks stretching across their body (Skogsberg et al 1939).

References

Skogsberg, T. 1939. The Fishes of the Family Sciaenidae (Croakers) of California. Division of Fish and Game of California, Bureau of Marine Fisheries, Fish Bulletin, 54:54-56.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Maggie Berrigan, Keri Nakama, Jacob Valk

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 510 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

56.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 2,490 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 45 m (Ref. 9118)
  • Chao, L.N. 1995 Sciaenidae. Corvinas, barbiches, bombaches, corvinatas, corvinetas, corvinillas, lambes, pescadillas, roncachos, verrugatos. p. 1427-1518. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para identificacion de especies para los fines de la pesca. Pacifico Centro-oriental. 3 volumes. 1813 p. (Ref. 9118)   http://www.fishbase.org/references/FBRefSummary.php?id=9118&speccode=13985 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This demersal species is found in shallow sandy areas, often in surf zones, bays and tidal sloughs, although it can be found to depths of 45m. It feeds on fishes, crustaceans, marine worms and bivalves. It is often caught by surf fishers.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 26
  Temperature range (°C): 19.787 - 19.787
  Nitrate (umol/L): 7.979 - 7.979
  Salinity (PPS): 35.191 - 35.191
  Oxygen (ml/l): 4.548 - 4.548
  Phosphate (umol/l): 1.320 - 1.320
  Silicate (umol/l): 18.854 - 18.854

Graphical representation

Depth range (m): 1 - 26
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 45m.
Recorded at 45 meters.

Habitat: demersal. Found in shallow sandy areas, often in surf zones, bays and tidal sloughs. Feeds on fishes, crustaceans, marine worms and bivalves (Ref. 9118) Often caught by surf fishermen.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Sand & gravel, Beach

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Umbrina roncador are a nearshore fish that reside over sandy sea floors in shallow water (Skogsberg 1939).

References:

Skogsberg, T. 1939. The Fishes of the Family Sciaenidae (Croakers) of California. Division of Fish and Game of California, Bureau of Marine Fisheries, Fish Bulletin, 54:54-56.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Maggie Berrigan, Keri Nakama, Jacob Valk

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in shallow sandy areas, often in surf zones, bays and tidal sloughs. Feeds on fishes, crustaceans, marine worms and bivalves.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

From late fall until the beginning of spring, Umbrina roncador gonads remain inactive (Skogsberg 1939). Gonadal condition indicates spawning can occur from June until August. In general, batch fecundities spanned from around 100,000 to 400,000 eggs per female (Miller et al. 2009).

References:

Miller. E.F., S. Goldberg, J. Nuñez, N. Burkes, J. Kuratomi. 2009. The Reproductive Biology of Two Common Surfzone Associated Sciaenids, Yellowfin Croaker (Umbrina roncador) and Spotfin Croaker (Roncador stearnsii), from Southern California. Bulletin, Southern California Academy of Sciences 108(3):152-159.

Skogsberg, T. 1939. The Fishes of the Family Sciaenidae (Croakers) of California. Division of Fish and Game of California, Bureau of Marine Fisheries, Fish Bulletin, 54:54-56.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Maggie Berrigan, Keri Nakama, Jacob Valk

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Umbrina roncador grow at a faster rate until the age of three and then growth rates level off as they reach sexual maturity. Despite this trend, it has been found that growth rates can vary substantially between individuals (Pondella et al. 2008).

References

Pondella, D. J., Froeschke, J. T., Wetmore, L. S., Miller, E., Valle, C. F. and Medeiros, L. 2008. Demographic Parameters of Yellowfin Croaker, Umbrina roncador (Perciformes: Sciaenidae), from the Southern California Bight. Pacific Science, 62(4): 555-568.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Maggie Berrigan, Keri Nakama, Jacob Valk

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Umbrina roncador

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCCTTCTAATCCGAGCAGAGCTAAGTCAACCTGGCTCCCTCCTAGGGGATGATCAAATCTATAATGTAATTGTTACGGCACATGCCTTCGTTATAATTTTCTTTATAGTAATGCCCATCATGATTGGAGGTTTCGGGAATTGACTCGTACCACTAATGATCGGGGCCCCTGATATAGCATTTCCCCGTATAAATAACATGAGCTTCTGACTTCTCCCTCCCTCCTTCCTCTTACTCCTGACCTCTTCAGGTGTAGAAGCCGGGGCAGGAACCGGGTGAACCGTCTACCCCCCACTCGCCGGTAATCTGGCGCACGCAGGGGCCTCCGTCGACTTGGCTATTTTCTCCCTACATCTTGCGGGTGTCTCCTCAATTCTAGGGGCCATCAACTTTATTACAACAATTATTAACATAAAACCCCCGGCCATCTCCCAATATCAAACCCCCTTATTTGTATGAGCTGTCCTAATTACTGCCGTTCTTCTCCTTCTCTCACTTCCCGTCTTAGCTGCTGGCATTACAATACTTCTCACAGATCGCAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGCGACCCCATTCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Umbrina roncador

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Chao, L., Espinosa, H.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is relatively widespread in the Eastern Pacific. Although the historic range has likely been reduced, and this species is heavily fished and threatened by coastal development, its population appears to be increasing in some parts of its range. It is listed as Least Concern. However, as this species this species population and habitat should continue to be carefully monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No population information is available for this species.

In Cabo Pulmo, Mexico, this fish was not found, although it was previously recorded there (Villarreal-Cavazos et al. 2000). In Bahía de Navidad, Jalisco, still in México, this fish was captured twice within 12 (one each month) field trips throughout a year (Rojo-Vázquez et al. 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is heavily fished and threatened by coastal development, however its population appears to be increasing in some parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).

Continued monitoring of this species population and fishing pressure is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
  • Chao, L.N. 1995 Sciaenidae. Corvinas, barbiches, bombaches, corvinatas, corvinetas, corvinillas, lambes, pescadillas, roncachos, verrugatos. p. 1427-1518. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para identificacion de especies para los fines de la pesca. Pacifico Centro-oriental. 3 volumes. 1813 p. (Ref. 9118)   http://www.fishbase.org/references/FBRefSummary.php?id=9118&speccode=13985 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellowfin croaker

Yellowfin croaker (Umbrina roncador) is a species of croaker occurring from the Gulf of California, Mexico, to Point Conception, California. They frequent bays, channels, harbors and other nearshore waters over sandy bottoms. These croakers are more abundant along beaches during the summer months and may move to deeper water in winter. They do not have a set size limit for the yellowfin croaker, so you can take any size.

Other common names include yellowfin drum, Catalina croaker, yellowtailed croaker, and golden croaker.

Contents

Description

Umbrina roncador mspc099.gif

The body of the yellowfin croaker is elliptical-elongate with the back somewhat arched. The head is conical and blunt. The color is iridescent blue to gray with brassy reflections on the back diffusing to silvery white below. The sides and back have many diagonal dark wavy lines. The fins are yellowish except for the dark dorsal fins. The yellowfin croaker differs from other California croakers in having a single fleshy projection, a barbel, on the lower jaw and two heavy spines at the front of the anal fin.

The diet of the yellowfin croaker consists mainly of small fishes and fish fry; however, invertebrates such as small crustaceans, worms and mollusks are also eaten in large numbers. Spawning takes place during the summer months when this species is most common along the sandy beaches. Maturity is apparently not reached until the fish are slightly over 9 inches long. The largest recorded specimen was 20.13 inches; no weight reported. However, an 18-inch yellowfin croaker weighed 4.5 pounds.

Fishing information

Yellowfin croaker are most often taken by surf anglers using softshelled sand crabs[disambiguation needed], worms, mussels, clams, Gulp! soft baits, or cut fish as bait. They are most commonly caught between Ventura County and Central Baja California.

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!