Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coral reef (Ref. 75154). Cryptic species, prefers darker areas of the reefs (Ref. 33410). Benthopelagic (Ref. 58302).
  • Randall, J.E. 1999 Revision of the Indo-Pacific labrid fishes of the genus Pseudocheilinus, with descriptions of three new species. Indo-Pac. Fish. (28):34 p. (Ref. 33410)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Pseudocheilinus ocellatus is found in the western south Pacific, including Pitcairn Islands, Tuamotu Archipelago, Rapa, Austral Islands, Society Islands, Johnston Islands (not Hawaii), Marshall Islands, Wake Island, Caroline Is. Also in Fiji, Loyalty Is, Coral Sea, Ryukyu Is and Ogasawara Is. (Randall 1999), Tahiti, Vanuatu, Australia, Cook Is., Line Is, French Polynesia, Micronesia, New Caledonia (Froese and Pauly 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western and Central Pacific: Ryukyu Islands, Ogasawara Islands, Wake Island and Johnston Atoll to Palau and Caroline Islands; Queensland (Australia) east to Pitcairn Group, south to Loyalty Islands (New Caledonia) and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific.
  • Randall, J.E. 1999 Revision of the Indo-Pacific labrid fishes of the genus Pseudocheilinus, with descriptions of three new species. Indo-Pac. Fish. (28):34 p. (Ref. 33410)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

10.3 cm SL (male/unsexed; (Ref. 33410))
  • Randall, J.E. 1999 Revision of the Indo-Pacific labrid fishes of the genus Pseudocheilinus, with descriptions of three new species. Indo-Pac. Fish. (28):34 p. (Ref. 33410)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Pseudocheilinus ocellatus Randall
Catalog Number: USNM 233579
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & et al.
Year Collected: 1982
Locality: Fiji Islands, Ono-Ilau, Outside Barrier Reef On NW Side of Island, Fiji, Fiji Islands, Pacific
Depth (m): 43
  • Paratype: Randall, J. E. April 1999. Indo-Pacific Fishes. No. 28: 21, 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Pseudocheilinus ocellatus Randall
Catalog Number: USNM 322408
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Hardcopy photograph on file
Collector(s): J. Williams, P. Tirard & J. Menou
Year Collected: 1991
Locality: Loyalty Islands; Ouvea Atoll; Motu Waaunyi Islet. Ocean Side of Fringing Reef, Vertical Wall On Reef., Ouvea Atoll, Loyalty Islands, New Caledonia, Pacific
Depth (m): 6 to 27
  • Paratype: Randall, J. E. April 1999. Indo-Pacific Fishes. No. 28: 21, 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Pseudocheilinus ocellatus Randall
Catalog Number: USNM 348495
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Williams, D. Smith, M. Westneat & M. McGrouther
Year Collected: 1996
Locality: Vanuatu, Erromango, Dillon'S Bay, SW Side of Bay Along Williams Point. Patch Reef On a Sand Flat., Erromango, Vanuatu, Vanuatu Islands, Pacific
Depth (m): 21 to 24
Vessel: Mv Lewia
  • Paratype: Randall, J. E. April 1999. Indo-Pacific Fishes. No. 28: 21, 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Pseudocheilinus ocellatus lives in depths between 20–60 m on coral reefs. It is a cryptic species, and prefers darker areas of the reef (Randall 1999; Munday 2005). It lives in deeper water than other congeners (Randall 1999). This species can be found in caves and overhangs of drop-offs (R. Myers pers. comm. 2009).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 20 - 58 m (Ref. 33410)
  • Randall, J.E. 1999 Revision of the Indo-Pacific labrid fishes of the genus Pseudocheilinus, with descriptions of three new species. Indo-Pac. Fish. (28):34 p. (Ref. 33410)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 22.5 - 53.35
  Temperature range (°C): 24.353 - 26.505
  Nitrate (umol/L): 0.091 - 0.434
  Salinity (PPS): 35.063 - 35.481
  Oxygen (ml/l): 4.630 - 4.814
  Phosphate (umol/l): 0.108 - 0.184
  Silicate (umol/l): 0.897 - 1.570

Graphical representation

Depth range (m): 22.5 - 53.35

Temperature range (°C): 24.353 - 26.505

Nitrate (umol/L): 0.091 - 0.434

Salinity (PPS): 35.063 - 35.481

Oxygen (ml/l): 4.630 - 4.814

Phosphate (umol/l): 0.108 - 0.184

Silicate (umol/l): 0.897 - 1.570
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocheilinus ocellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATATTTAGTATTTGGTGCTTGGGCCGGAATGGTAGGCACAGCCCTGAGCCTACTTATCCGAGCAGAACTAAGTCAACCAGGAGCTCTTCTGGGCGACGACCAAATCTATAACGTAATTGTTACTGCGCATGCTTTCGTAATGATCTTTTTTATGGTTATGCCAATCATGATTGGTGGGTTTGGCAACTGACTAATCCCCCTAATGATCGGCGCCCCCGACATGGCATTCCCTCGAATGAACAATATGAGCTTCTGACTCCTTCCGCCCTCCTTCCTACTCCTCCTAGCCTCATCAGGCGTAGAGGCCGGGGCCGGGACAGGATGAACAGTTTACCCACCACTAGCTGGTAATCTTGCACACGCTGGGGCCTCCGTTGACCTGACCATCTTCTCCCTCCACCTTGCAGGGATTTCTTCTATTTTAGGTGCCATCAACTTCATTACTACCATCATCAACATGAAACCTCCTGCGATTTCACAGTACCAAACCCCACTCTTCGTGTGAGCAGTACTAATTACCGCCGTTCTCCTCCTCCTTTCTCTTCCTGTCCTAGCCGCCGGCATCACAATGCTTCTGACAGACCGAAACCTCAATACAACCTTCTTCGACCCTGCAGGAGGAGGTGACCCAATCCTCTACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocheilinus ocellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Sadovy, Y.J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Pseudocheilinus ocellatus has been assessed as Least Concern. This species is widespread in the western south Pacific, and is cryptic. There is no population information, and there are no known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for Pseudocheilinus ocellatus. This species is cryptic, and is therefore difficult to study.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for Pseudocheilinus ocellatus, although it is collected for the aquarium trade, but not commonly traded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Pseudocheilinus ocellatus, however its distribution may coincide with a number of marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pseudocheilinus ocellatus

The white-barred wrasse, Pseudocheilinus ocellatus, is a species of wrasse native to the central western Pacific Ocean. It inhabits coral reefs at depths from 20 to 58 m (66 to 190 ft). This species can grow to 10.3 cm (4.1 in) in standard length. It can also be found, under the trade name "mystery wrasse",[2] in the aquarium trade.[3]

References[edit]

  1. ^ Sadovy, Y.J. 2010. Pseudocheilinus ocellatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 15 November 2013.
  2. ^ Mystery Wrasse, Liveaquaria.com
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Pseudocheilinus ocellatus" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!