Overview

Comprehensive Description

Biology

Nocturnal (Ref. 37108), inhabits clear reefs (Ref. 5217). Found near mouths of caves and holes (Ref. 26938); at night they usually move to sandy areas and grass beds to feed on crabs, shrimps, gastropods and brittle stars (Ref. 3724). Marketed fresh but not popular as a food fish (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda and southern Florida, USA to northern South America and Brazil; throughout the West Indies (Ref. 3724). Antilles, northwestern Gulf of Mexico, Yucatan to Colombia (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic near coast of North Carolina (U.S.A.), Gulf of Mexico, Caribbean Sea, and near the Antilles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 4; Analsoft rays: 9 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 5217))
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Conspicuous white spot behind tip of each dorsal spine (Ref. 26938). Body slender. Upper jaw extending posteriorly to middle of pupil (Ref. 37108). Body bright red or red striped, sometimes blotched (Ref. 7251). Similar in color to H. ascensionis, but each interspinous membrane of dorsal fin with a white spot near margin (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 32 m (Ref. 3724)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 43 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0 - 61
  Temperature range (°C): 23.714 - 28.035
  Nitrate (umol/L): 0.174 - 2.722
  Salinity (PPS): 34.880 - 36.594
  Oxygen (ml/l): 4.527 - 4.764
  Phosphate (umol/l): 0.046 - 0.164
  Silicate (umol/l): 0.921 - 3.502

Graphical representation

Depth range (m): 0 - 61

Temperature range (°C): 23.714 - 28.035

Nitrate (umol/L): 0.174 - 2.722

Salinity (PPS): 34.880 - 36.594

Oxygen (ml/l): 4.527 - 4.764

Phosphate (umol/l): 0.046 - 0.164

Silicate (umol/l): 0.921 - 3.502
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 32m.
Recorded at 32 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits clear reefs (Ref. 5217). Nocturnal (Ref. 37108). Found near mouths of caves and holes (Ref. 26938); at night they usually move to sandy areas and grass beds to feed on crabs, shrimps, gastropods and brittle stars (Ref. 3724). Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holocentrus rufus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTTGGTACAGCCCTTAGCCTTCTAATCCGAGCTGAACTGAGCCAACCCGGAGCTCTTCTGGGGGACGACCAGATTTATAATGTTATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGATTTGGTAATTGACTAATTCCTTTAATAATCGGAGCCCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTCTGATTACTTCCCCCTTCATTCCTACTTCTACTAGCCTCCTCTGGTGTAGAAGCTGGTGCTGGGACAGGGTGAACAGTTTATCCACCCCTTGCAGGCAATCTAGCACACGCAGGAGCCTCTGTAGATCTCACCATCTTCTCCCTCCACCTAGCAGGTATTTCCTCAATTCTAGGAGCTATTAACTTCATTACAACTATCATTAATATGAAACCTCCCGCTATTTCTCAGTATCAAACACCTCTCTTCGTATGAGCCGTTCTAATTACAGCCGTTCTTCTCCTTCTATCCCTGCCTGTACTTGCAGCAGGTATTACCATGCTACTGACAGACCGAAACCTAAATACAACATTCTTCGACCCAGCAGGTGGAGGAGACCCAATTCTTTACCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Holocentrus rufus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Longspine squirrelfish

The longspine squirrelfish is silvery red, with orange-gold body stripes. One of about 150 species of squirrelfish, their most distinguishing characteristics are their large eyes and the long third spine of the anal fin. It is often included in public aquarium displays. The length of the longspine squirrelfish is about 18 cm (7.8 inches). It lives in coral reefs in tropical and warm temperate seas and eats zoobenthos. It is territorial and uses sounds called “grunts” and “staccatos” to defend its crevice, warn of danger and, in groups, intimidate predators such as the moray eel. The longspine squirrelfish is edible and harvested on a small scale.

Identification[edit]

Longspine squirrelfish (Holocentrus rufus); Musée Océanographique de Monaco, photo by Georges Jansoone

The body of the longspine squirrelfish is silvery red, with orange-gold body stripes. Its eyes are very large, which is characteristic of all squirrelfish. The rear dorsal fin is pronounced and sticks up. The anal fin has a strongly elongated third spine, from which this squirrelfish gets its name.[1]

There are about 150 species of squirrelfish. Squirrelfish, belonging to the order of Beryciformes, are brightly colored, medium-sized fish that are active during the night. Squirrelfish live in rocky or coral reefs in tropical and warm-temperate seas. Their most distinguishing characteristics are their large eyes. To identify the longspine squirrelfish, in addition to recognizing the long third spine of the anal fin, it can be useful to pay attention to the specific anatomy of other fins:[2]

FeatureNumber
Dorsal spines11
Dorsal soft rays14-16
Anal spines4
Anal soft rays9-11

Distribution[edit]

Longspine squirrelfish are marine fish that live in coral reefs. The length of the longspine squirrelfish is up to 18 cm (7.8 inches). They are found along the south eastern coast of the United States to Northern South America and Brazil, as well as in-between locations such as Bermuda and the West Indies.[3] They hide in or near dark recesses. They are territorial and defend their crevices with visual and acoustic displays. They are rare on shallow reefs. They are more abundant with increasing depth and are most abundant between thirty and seventy meters.

The juveniles are thin, silvery pelagics and seldom seen.

Food[edit]

Most of the food longspine squirrelfish eat is zoobenthos, including crustaceans, mollusks, and gastropods.[4] It tends to guard its territory during the day and feed more actively at night.

Sounds[edit]

Vocalization has been described in 30 families of fishes. Aggressive sounds tend to be middle-frequency (about one kHz). Distressed sounds can be a bit higher frequency (about 6 kHz).[5] Longspine squirrelfish make two kinds of sounds, a single “grunt” and a short burst of sounds called a “staccato.” The grunt sounds are used mostly to defend their territory. The staccato sound indicates alarm. Other longspine squirrelfish hearing the staccato sound will first retreat into their crevices, then come out to investigate the threat. Sometimes several of them make staccato sounds to scare away predators like the moray eel. This behavior is called “mobbing.”[6] Researchers have observed that the longspine squirrelfish makes sounds more frequently at dusk.

Importance to humans[edit]

Squirrelfish in general are of low commercial importance, but they are frequently taken on a small scale off of Brazil and Venezuela with traps, handlines, and gillnets. They show resilience through the ability to survive for days within traps and to survive in highly polluted waters. They are sometimes marketed fresh. They are commonly displayed in public aquarium facilities due to their beautiful red coloration and distinctively large eyes.[7]

In a 1980 study, longspine squirrelfish were determined to be quite edible among 16 different species of finfish obtainable off of the South Carolina coast of the United States.[8] A taste panel of thirteen individuals gave it high marks for firmness, average marks for flavor, and lower marks for flakiness compared with other species sampled. It was judged to be most similar to the short bigeye and the (much larger) red drum.

References[edit]

  1. ^ http://species-identification.org/species.php?species_group=caribbean_diving_guide&id=260
  2. ^ FishBase.org page on longspine squirrelfish
  3. ^ FishBase.org page on longspine squirrelfish
  4. ^ Sierra, L.M., R. Claro and O.A. Popova, 1994 Alimentacion y relaciones tróficas. p. 263-284. In: Rodolfo Claro (ed.) Ecología de los Peces Marinos de Cuba. Instituto de Oceanología Academia de Ciencias de Cuba and Centro de Investigaciones de Quintana Roo, Mexico.
  5. ^ Ladich, F. Agonistic behaviour and significance of sounds in vocalizing fish. Mar. Fresh. Behav. Physiol., Vol. 29, pp. 87-108
  6. ^ Ladich, F. Agonistic behaviour and significance of sounds in vocalizing fish. Mar. Fresh. Behav. Physiol., Vol. 29, pp. 87-108; Winn HE , Marshall JA , Hazlett B. Behavior, deil activities, and stimuli that elicit sound production and reactions to sounds in the longspine squirrelfish. Copeia 1964(2):413-425, 1964
  7. ^ Ichthyology at the Florida Museum of Natural History
  8. ^ Chapman S , Hale M , Ng L. A preliminary study of the edibility characteristics of southeastern finfish. Texas A&M university, 1980 read online
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!