Overview

Comprehensive Description

Biology

Associated with floating Sargassum (Ref. 4509). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic north of equator.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Maine (USA), Bermuda and northern Gulf of Mexico to Argentina. Nova Scotia, Antilles, western Caribbean from Yucatan to Colombia (Ref. 26938). Taxonomic status of the eastern Atlantic population (from Mauritania to Gabon) needs further study and records from Cape of Good Hope, South Africa and the Indo-Pacific area require confirmation (Ref. 4509).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maine, southward to the northern coast of Columbia; in the Gulf of Mexico, western Caribbean Sea, and the Antilles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Maine (USA), Bermuda and northern Gulf of Mexico to Argentina. Nova Scotia, Antilles, western Caribbean from Yucatan to Colombia . Records from Cape of Good Hope, South Africa and the Indo-Pacific area require confirmation. Also, there are some taxonomic issues to be resolved.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Dawson, C. E., 1990; Smith, C. L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 2831
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 181 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

18.1 cm SL (male/unsexed; (Ref. 4509))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 18.1 cm SL (male/unsexed).
  • Bigelow, H. B. and Schroeder, W. C., 1953; Dawson, C. E., 1990; Smith, C. L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Slender, long snout (1.4-1.7 in head length) (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

associated with floating Sargassum
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 3767
  Temperature range (°C): 4.226 - 26.764
  Nitrate (umol/L): 0.394 - 33.242
  Salinity (PPS): 34.989 - 36.442
  Oxygen (ml/l): 2.516 - 5.209
  Phosphate (umol/l): 0.120 - 1.936
  Silicate (umol/l): 1.608 - 25.869

Graphical representation

Depth range (m): 0 - 3767

Temperature range (°C): 4.226 - 26.764

Nitrate (umol/L): 0.394 - 33.242

Salinity (PPS): 34.989 - 36.442

Oxygen (ml/l): 2.516 - 5.209

Phosphate (umol/l): 0.120 - 1.936

Silicate (umol/l): 1.608 - 25.869
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; marine. Associated with floating Sargassum.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Dawson, C. E., 1990; Smith, C. L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Minute Crustacea, fish eggs, very small fish fry, and any other small marine animals.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Dawson, C. E., 1990; Smith, C. L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

no information
  • Bigelow, H. B. and Schroeder, W. C., 1953; Dawson, C. E., 1990; Smith, C. L., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus pelagicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCATGAGCCGGAATAGTGGGCACCGCACTTAGCCTTTTAATCCGGGCAGAACTTAGTCAACCGGGGGCCCTTCTTGGCGATGATCAAATTTATAATGTAATCGTTACAGCCCACGCTTTTGTTATGATTTTTTTCATGGTCATACCTATCATGATTGGAGGATTTGGCAACTGATTAGTACCCCTAATGATTGGAGCCCCCGACATAGCATTCCCCCGAATGAATAACATGAGTTTCTGACTCCTGCCCCCTTCCTTCTTACTCCTTCTTGCTTCCTCAGGAGTAGAGGCGGGTGCAGGCACAGGGTGAACTGTCTACCCCCCTCTCTCGGGTAATTTAGCCCATCAGGGAGCCTCTGTGGATCTAACAATCTTCTCCCTGCACTTAGCAGGTGTATCCTCAATTCTAGGGGCTATTAACTTCATTACCACTATTATTAATATGAAGCCCCCCTCAATCTCCCAATACCAAACACCCCTCTTTGTCTGAGCTGTGCTAATCACTGCTGTGTTACTCCTCCTCTCCCTGCCTGTCTTAGCAGCCGGCATTACTATGCTTTTAACTGACCGAAATTTAAACACGACTTTCTTCGACCCTGCGGGAGGTGGTGATCCTATTCTCTACCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus pelagicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sargassum pipefish

Sargassum pipefish (Syngnathus pelagicus) is a species of pipefishes, which found in the western Atlantic: Maine (USA), Bermuda, northern Gulf of Mexico to Argentina, Nova Scotia, Antilles, western Caribbean Sea from Yucatan to Colombia. Marine subtropical species, up to 18.1 cm maximal length. Habits growth of Sargassum algae.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!