Overview

Brief Summary

Syngnathus leptorhynchus, the bay pipefish, can be found in nearshore eelgrass beds across a broad latitudinal range, with populations found from Bahia Santa Maria, Baja California to Prince William Sound, Alaska (Wilson 2009). S. leptorhynchus has undergone a northern range expansion (Orsi et al. 1991, Wilson 2006). A defining characteristic of bay pipefish’s family (Syngnathidae) is their high degree of paternal parental care, as the males have developed specialized brood pouches for the incubation of eggs deposited by females. Fathers undergo a labor-intensive pregnancy, supporting the embryos until they are released as free-living juveniles (Vincent et al. 1992, Wilson et al. 2003). Bay pipefish reach sexual maturity in a relatively quick period of 60-80 days. Depending on their geographical location, populations of pipefish can reproduce year round (southern populations) or the reproductive season can be limited to only a brief period of two months (Fritzsche 1980, Wilson 2009). They consume small planktonic prey, such as mysid shrimp (Van Wassenberg et al. 2008).

References:

Fritzsche, R.A. 1980. Revision of the eastern Pacific Syngnathidae (Pisces: Syngnathiformes), including both recent and fossil forms. Processings of the California Academy of Sciences, USA, 42: 181-227.

Orsi, J.A., R.K. Gish, B.L. Wing. 1991. Northern range extensions of four nearshore marine fishes in Alaska. Canadian Field-Naturalist, 105: 82-86.

Van Wassenbergh, Sam, J. A. Strother, B. E. Flammang, L. A. Ferry-Graham, and P. Aerts. 2008. Extremely Fast Prey Capture in Pipefish Is Powered by Elastic Recoil. Journal of The Royal Society Interface, 5: 285-96.

Vincent, A., I. Ahnsejo, A. Berglund, and G. Rosenqvist. 1992. Pipefishes and seahorses: Are they all sex role reversed? Trends Ecology and Evolution, 7: 237-241.

Wilson, Anthony B., I. Ahnesjö, A. C. J. Vincent, and A. Meyer. 2003. The Dynamics Of Male Brooding, Mating Patterns, And Sex Roles In Pipefishes And Seahorses (Family Syngnathidae). Evolution, 57: 1374-386.

Wilson, A. B. 2006. Interspecies mating in sympatric species of Syngnathus pipefish. Molecular Ecology, 15: 809–824.

Wilson, A. B. 2009. Fecundity selection predicts Bergmann's rule in syngnathid fishes. Molecular Ecology, 18: 1263–1272.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Alvarado, Marlena Lu, Morgan Winston

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Common in eelgrass of bays and estuaries, sometimes taken in shallow offshore waters (Ref. 5316). Feeds on crustaceans (Ref. 6885). Females larger than males (R.C. de Graaf, pers. Comm., 2001; Ref. 93899). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Sitka, Alaska to southern Baja California in Mexico; the northern population ranges from Alaska to Monterey Bay, southern population from Morro Bay southward.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northeastern Pacific: Southern Alaska to Baja California, Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Syngnathus leptorhynchus, bay pipefish, has a distinguishing elongated snout and four-bar linkage morphology that facilitates prey capture. The bay pipefish has an elongated snout composed of neurocranial and suspensorial components. Their extended snout also relates to increased prey capture speed (Flammang et al. 2009). Another important factor to their prey capture speed is elastic recoil, which is associated with moving the pipefish’s mouth near its prey (Van Wassenbergh et al. 2008).

References:

Flammang, BE, Ferry-Graham LA, Rinewalt C, Ardizzone D, Davis C, Trejo T. 2009. Prey capture kinematics and four-bar linkages in the bay pipefish, Syngnathus leptorhynchus. Zoology, 112:86-96.

Van Wassenbergh, Sam, James A. Strother, Brooke E. Flammang, Lara A. Ferry-Graham, and Peter Aerts. 2008. Extremely Fast Prey Capture in Pipefish Is Powered by Elastic Recoil. Journal of The Royal Society Interface, 112: 285-96.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Alvarado, Marlena Lu, Morgan Winston

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

32.5 cm TL (male/unsexed; (Ref. 93899)); 38.5 cm TL (female)
  • Bayer, R.D. 1980 Size, seasonality, and sex ratios of the bay pipefish (Syngnathus leptorhynchus) in Oregon. Northwest Science 54(3):161-167. (Ref. 93899)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 330 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Syngnathus leptorhynchus
Catalog Number: USNM 31253
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Larco
Locality: Santa Barbara, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Syngnathus leptorhynchus
Catalog Number: USNM 971
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Williamson
Locality: San Diego, San Diego County, California, United States, North America, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Syngnathus leptorhynchus
Catalog Number: USNM 972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Suckley
Locality: Coast of Cala, California, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Syngnathus leptorhynchus
Catalog Number: USNM 969
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Trowbridge
Locality: San Diego, Cal., San Diego County, California, United States, North America, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.455 - 133
  Temperature range (°C): 10.476 - 10.476
  Nitrate (umol/L): 4.616 - 4.616
  Salinity (PPS): 31.499 - 31.499
  Oxygen (ml/l): 6.682 - 6.682
  Phosphate (umol/l): 0.748 - 0.748
  Silicate (umol/l): 10.583 - 10.583

Graphical representation

Depth range (m): 0.455 - 133
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

A female wraps herself around a male in a rigid vertical S position. Eggs are fertilised in the brood pouch of the male (Ref. 6885).
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bay pipefish, Syngnathus leporhychus, are a polygamous species characterized by a high degree of male uniparental care. Like other members of the Syngnathidae family, male bay pipefish are assured to be the father of the embryos they care for, as fertilization takes place within their pouch (Ahnesjo 1992, Foster and Vincent 2004, Wilson 2006). S. leptorhynchus become sexually mature at 60-80 days (Fritzsche 1980, Wilson 2009), with reproductive activity overall higher during summer months (Fritzsche 1980, Wilson 2006). However, this activity varies in populations depending on their geographical location; southern populations have been found to reproduce often throughout the year, while some northern populations reproduce in a period of two months. It is possible that within one year, male bay pipefish found in California are able to raise as many as 12 broods (Fritzsche 1980, Wilson 2009). Female S. leptorhynchus in northern populations may participate in “bet-hedging”, where they mate with and distribute their eggs across multiple males since in a harsh environment the chances are lower that the offspring from each male will survive (Wilson 2009).

References:

Ahnsejo, I. 1995. Temperature affects male and female potential reproductive rates differently in the sex-role reversed pipefish, Syngnathus typhle. Behavioral Ecology, 6: 229-233.

Foster, S.J., Vincent, A.C.J. 2004. Life history and ecology of seahorses: implications for conservation and management. Journal of Fish Biology, 65: 1-61.

Fritzsche, R.A. 1980. Revision of the eastern Pacific Syngnathidae (Pisces: Syngnathiformes), including both recent and fossil forms. Processings of the California Academy of Sciences, USA, 42: 181-227.

Wilson, A. B. 2006. Interspecies mating in sympatric species of Syngnathus pipefish. Molecular Ecology, 15: 809–824.

Wilson, A. B. 2009. Fecundity selection predicts Bergmann's rule in syngnathid fishes. Molecular Ecology, 18: 1263–1272.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Alvarado, Marlena Lu, Morgan Winston

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

The Syngnathus leptorhynchus species is found along the Pacific coast ranging from Bahia Santa Maria, Baja California to Prince William Sound, Alaska. Due to this large range of distribution of S. leptorhynchus, scientists are debating whether there is a single species of bay pipefish or several subspecies (Wilson 2006). Genetic evidence suggests that the southern population of S. leptorhynchus has been separated from the northern populations for a significant period of time, although there is not enough evidence to conclude that the California population is a genetically distinct species from the populations found in Alaska, Washington, and Oregon (Herald 1941, Wilson 2006).

References:

Herald E.S. 1941. A systematic analysis of variation in the western American pipefish, Syngnathus californiensis. Stanford Ichthyological Bulletin, 2: 49–73.

Wilson, A. B. 2006. Genetic signature of recent glaciation on populations of a near-shore marine fish species (Syngnathus leptorhynchus). Molecular Ecology, 15: 1857–1871.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Alvarado, Marlena Lu, Morgan Winston

Source: Biology 260 Occidental College

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Syngnathus leptorhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTATATCTAGTATTTGGTGCATGAGCCGGAATGGTGGGTACTGCACTTAGCCTTCTCATCCGAGCAGAACTAAGTCAACCAGGAGCCCTTTTGGGTGACGACCAAATTTATAATGTAATCGTTACAGCCCATGCTTTTGTTATAATCTTCTTTATAGTTATACCAATTATAATTGGTGGTTTCGGTAATTGACTGATCCCTTTAATAATTGGAGCTCCAGATATAGCATTTCCCCGGATAAATAACATAAGTTTTTGACTTCTTCCACCATCTTTCCTTCTCCTTCTCGCCTCATCAGGAGTAGAAGCAGGGGCAGGAACAGGATGAACCGTATATCCCCCTCTTTCAGGGAATTTAGCACATCAAGGAGCCTCCGTAGATCTGACTATTTTCTCCCTACATTTAGCAGGAGTATCCTCAATTTTAGGGGCTATTAACTTCATCACTACTATTATTAACATAAAACCTCCCTCAATCTCTCAATACCAGACGCCCTTATTTGTTTGAGCCGTACTAATTACTGCTGTATTACTTCTTCTATCTTTACCCGTTTTAGCAGCCGGTATCACTATGCTTTTAACTGACCGAAATTTAAACACAACTTTTTTTGATCCAGCAGGAGGGGGAGATCCTATCCTTTATCAACACCTGTTCTGATTCTTCGGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus leptorhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bay pipefish

The Bay Pipefish (Syngnathus leptorhyncus) is a pipefish native to the eelgrass beds of the Eastern Pacific (Southern Baja California to Gulf of Alaska),[1] where its sinuous shape and green color allow it to blend in with the waving blades of eelgrass. Like other members of the seahorse family, male pipefish tend the eggs laid by their female partners in specialized pouches.[2][3]

References

  1. ^ a b "Syngnathus leptorhynchus, Bay pipefish : aquarium." Web. 10 Dec 2009. http://www.fishbase.org/Summary/SpeciesSummary.php?id=3303
  2. ^ "Splendor in the Grass — Bay Nature Institute." Web. 10 Dec 2009. http://baynature.org/articles/apr-jun-2009/splendor-in-the-grass
  3. ^ Lamb, A, and Edgell, P. 2010. Coastal Fishes of the Pacific Northwest. British Columbia: Harbour Publishing.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!