Overview

Comprehensive Description

Syngnathus acus ZBK Linnaeus, 1758

Sea of Marmara : 10200-683 (1 spc), 11.02.1995 , western waters of Imrali Island , trawl , 51 m, L. Eryilmaz . Aegean Sea : 10200-709 (1 spc), January 2001 , Bozcaada Island , trammel net , 30m, L. Eryilmaz . Inland water: 10200-187 (1 spc), March 1974 , Bueyuekcekmece Lagoon , Istanbul , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 42-42, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in coastal and estuarine waters to depths of at least 110 m (Ref. 4281); on sand, mud and rough bottoms. Common amongst algae and eel-grass (Zostera) (Refs. 4146, 6733, 88187). Feeds mainly on small crustaceans (Ref. 85544).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Body slender and elongate, light greenish to dark brown in colour with variable markings. Pectoral, dorsal, anal and tail fins present. Snout cylindrical, equal to or less than eye diameter. There are 18 -19 body rings between head and dorsal fin
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Pipefish belong to the same family of fish as the sea-horses (Syngnathidae). They have long, slender bodies encased in an armour of segmented plates. The main body of the greater pipefish is polygonal in cross-section whilst the tail end is four-sided, giving the body an angular appearance. It has a relatively long snout with a small mouth at the tip. There is a distinctive hump on top of the head behind the eyes. It is usually pale brown to greenish-brown in colour with darker bands along the body. Adult fish can grow to a maximum length of 47cm. The greater pipefish most closely resembles Nilsson's pipefish (Syngnathus rostellatus) however the latter does not have a conspicuous hump behind the eyes and has a much shorter snout. The deep-snouted pipefish (Syngnathus typhle) is also similar but it too lacks a hump behind the eyes and has a much deeper snout.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Baltic Sea, North Sea, Mediterranean Sea, Black Sea, eastern Atlantic: Norway to Gambia including Madeira.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: Norway, Faroes and British Isles to Western Sahara, Senegambia, and from Namibia to Cape of Good Hope and northward to the coast of Zululand in the western Indian Ocean (Ref. 4127). Also throughout the Mediterranean, Aegean and Black seas. Despite literature records, occurrence in the Indo-Pacific outside South African waters lacks conclusive evidence (Ref. 4281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 33 - 42; Analspines: 0; Analsoft rays: 3
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 460 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 35388))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found in coastal and estuarine waters to depths of 90 m or more; on sand, mud and rough bottoms. Common amongst algae and eel-grass (@Zostera@) (Ref. 6733).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Light greenish to dark brown in color with variable markings (Ref. 4281). Snout cylindrical, equal to or less than eye diameter. With 18 - 19 body rings between head and dorsal fin (Ref. 35388). The snake pipefish (Entelurus aequoreus) is distinguished by the lack of pectoral and anal fins (Ref. 88171). An elongated bump on top of head behind eye (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Syngnathus acus
Catalog Number: USNM 214484
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Trowbridge
Locality: San Diego, Cal., San Diego County, California, United States, North America, Pacific
  • Paralectotype: ; Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14: 282-284.; Syntype: ; Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14: 282-284.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Syngnathus acus
Catalog Number: USNM 8128
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1880
Locality: San Diego, Cal., San Diego County, California, United States, Pacific
  • Lectotype: ; Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14: 282-284.; Syntype: ; Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14: 282-284.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 110m.
Recorded at 110 meters.

Habitat: demersal. Found in coastal and estuarine waters to depths of at least 110 m (Ref. 4281); on sand, mud and rough bottoms. Common amongst algae and eel-grass (@Zostera@) (Ref. 6733).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; non-migratory (Ref. 88171); brackish; marine; depth range 0 - 110 m (Ref. 4281), usually 3 - 12 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1828 specimens in 1 taxon.
Water temperature and chemistry ranges based on 718 samples.

Environmental ranges
  Depth range (m): -9 - 750
  Temperature range (°C): 6.664 - 18.507
  Nitrate (umol/L): 1.692 - 16.868
  Salinity (PPS): 22.343 - 38.648
  Oxygen (ml/l): 4.413 - 7.118
  Phosphate (umol/l): 0.179 - 0.991
  Silicate (umol/l): 1.778 - 11.419

Graphical representation

Depth range (m): -9 - 750

Temperature range (°C): 6.664 - 18.507

Nitrate (umol/L): 1.692 - 16.868

Salinity (PPS): 22.343 - 38.648

Oxygen (ml/l): 4.413 - 7.118

Phosphate (umol/l): 0.179 - 0.991

Silicate (umol/l): 1.778 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found in shallow waters among seaweed or rockpools and to depths of about 90 m. It can also be found on sand and mud extending into the mouths of estuaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pipefish are usually found in muddy or sandy areas living amongst seaweed or sea-grass at depths down to 20m. They feed on small planktonic organisms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Visual, low-level predator. Feeds primarily during the day (Ref. 58137), preying mainly on small crustaceans (Ref. 89327).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous; reproducing on average 3 times each year (Ref. 89328). Several females depositing partial clutches to a male’s brood pouch under the tail (Refs. 205, 31201). Up to 400 eggs may be found in a single pouch (Ref. 89329). Brooding males occur mainly between May and July (Refs. 31201, 58137). During the breeding season, both males and females were observed to remain low amongst the seagrass in one meadow (Ref. 31201). Gestation period lasts about 5 weeks and size at birth is 1.7- 3.5 cm (Refs. 58137, 88187, 89330). Aquarium experiments have shown that new born young are benthic, remaining close to the bottom Ref. 89330).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus acus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTGTATCTAGTATTTGGTGCATGAGCCGGAATAGTGGGCACCGCACTCAGCCTTCTAATCCGAGCAGAACTTAGTCAACCGGGAGCCCTCTTGGGTGATGACCAAATTTATAATGTAATCGTTACAGCCCATGCTTTTGTCATGATCTTCTTCATAGTAATACCTATCATGATTGGAGGTTTCGGCAACTGGTTGGTACCCCTAATAATTGGAGCCCCAGACATAGCATTCCCCCGGATGAATAACATAAGTTTCTGACTACTACCTCCCTCCTTCCTACTCCTCCTTGCCTCCTCAGGAGTAGAGGCAGGTGCAGGCACAGGATGGACTGTTTACCCACCTCTTTCAGGTAATTTGGCTCACCAGGGGGCTTCTGTTGATCTCACAATTTTTTCTTTACACCTAGCAGGTGTCTCCTCAATCTTAGGGGCTATTAACTTTATTACCACTATTATTAATATAAAACCCCCCTCAATTTCCCAGTATCAAACACCCCTTTTTGTCTGAGCTGTATTAATTACTGCCGTCTTACTCCTTCTATCCCTGCCCGTCCTAGCAGCTGGCATTACTATGCTTTTAACTGACCGAAATCTAAACACAACTTTCTTTGACCCCGCAGGAGGTGGAGACCCTATTCTCTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus acus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater pipefish

The Greater pipefish, (Syngnathus acus, Linnaeus, 1758),[1] is a pipefish of the family Syngnathidae. It is a seawater fish and the type specimen of the genus Syngnathus.

Description[edit]

Greater pipefish in the Zostera growth

The Greater pipefish has a long segmented armoured body, angular in cross section and stretching up 45 cm long with its stiff appearance. It ranges a color brown to green in with broad alternating light and dark hue along it. Its customized by a long snout with mouth on end and a slight hump on the top of the body just behind the eyes. Common on southerly and westerly coasts in a variety of habitats, often amongst seaweeds and seagrass. The fish is generally 33 cm to 35 cm in length with a reported maximum length of 47 cm. They are almost square in each segment of the body, and known to feel rigid when handled. The Greater pipefish has distinctive body rings which are a sandy brown with darker bars covering his body in between.[2]

Anatomy[edit]

The anatomy of fish vary through the sex. The top third of the females belly is deep (when egg bound), twice the breadth of the lower two thirds below the vent. The male is the "tailing" with the twin folds below the vent. The folds of the skin make the middle third and during the "brooding" of the young they swell in size until the young are released from the pouch (at a size of 22 mm to 35 mm).

Distribution, habitat and feeding[edit]

The Greater Pipefish is found all around the British Isles and is regularly found in the Mediterranean Sea. Its habitat is usually among seaweed and seagrass. It feeds on live mysids and small prawns.[1]

Syngnathus temminckii[edit]

The southern African species Syngnathus temminckii (Kaup, 1856) was until recently synonymised with S. acus. However, morphological data clearly show that it is distinct, and genetic data indicate that it is not even the sister taxon of S. acus, but of another southern African species, the river pipefish S. watermeyeri (Mwale et al., in press).

Gallery[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!