Overview

Distribution

Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Atlantic: Argentina.
  • Eschmeyer, W.N. (ed.) 2006 Catalog of fishes. Updated database version of April 2006. Catalog databases as made available to FishBase in April 2006. (Ref. 56787)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 4 - 4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus patagonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTGTACTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGTACTGCACTCAGCCTTTTAATCCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTAGGGGACGATCAGATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTTTTCATAGTCATACCCATCATAATCGGAGGTTTTGGTAACTGGTTGATCCCTTTAATAATTGGGGCACCCGATATAGCCTTTCCTCGAATAAATAACATAAGTTTTTGATTACTACCCCCCTCCTTCCTCCTCCTTCTTGCTTCATCAGGAGTAGAAGCCGGGGCGGGCACAGGCTGAACTGTCTACCCCCCGCTAGCAGGCAATTTAGCACATGCCGGAGCCTCTGTTGACTTGACAATCTTCTCTCTTCACCTAGCAGGAGTCTCATCAATTCTAGGAGCTATTAACTTTATTACCACTATTATTAATATAAAACCCCCATCAATTTCACAATATCAAACACCATTGTTTGTATGAGCAGTTTTAGTAACTGCAGTTCTACTCCTATTATCCCTACCTGTTCTGGCAGCCGGTATTACTATACTTCTTACAGATCGAAATTTAAATACAACATTTTTTGATCCTTCCGGAGGGGGAGACCCTATTCTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus patagonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hippocampus patagonicus

The patagonian seahorse (Hippocampus patagonicus) is a species of fish in the Syngnathidae family. It lives in the southwest Atlantic Ocean.

References[edit source | edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Hippocampus patagonicus" in FishBase. junio 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!