Overview

Comprehensive Description

Biology

Inhabits coral reefs, young usually in adjacent seagrass beds. Often rests on the bottom (Ref. 9710). Feeds on plants. Solitary or in small groups. A protogynous hermaphrodite (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The species is known from Bermuda and Florida (USA) to Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda, Florida (USA), and Bahamas to Central America and Brazil; throughout the Caribbean Sea (Ref. 3802).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 280 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults of both sexes have distinct white spot behind base of dorsal fin; super males with red line from corner of mouth to below back of eye; and 2 or more jet-black spots on side above pectoral fin (Ref. 26938). The smaller color phase is brown or greenish brown with a dark blue cast on the back and sides, becoming red ventrally (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in reef and sea grass habitats from 2-20 m depth. It inhabits clear coral and algal-rich reefs. It is solitary or in small groups and feeds on algae. It is a protogynous hermaphrodite. Juveniles are often found in seagrass beds.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3869 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2454 samples.

Environmental ranges
  Depth range (m): 0.375 - 34
  Temperature range (°C): 24.448 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 4.285 - 4.773
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.375 - 34

Temperature range (°C): 24.448 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 4.285 - 4.773

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 20m.
From 2 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs, young usually in adjacent seagrass beds. Often rests on the bottom (Ref. 9710). Feeds on plants. Herbivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

A monandric species (Ref. 55367). Length at sex change = 17.5 cm TL (Ref. 55367). Forms harem groups composed of a single male and several smaller females (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sparisoma aurofrenatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sparisoma aurofrenatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTTGTATTTGGTGCCTGAGCTGGAATAGTAGGCACTGCTTTAAGCCTTCTTATCCGAGCTGAACTCAGCCAACCCGGGGCCCTTCTCGGAGACGACCAAATTTATAACGTAATTGTTACCGCTCACGCGTTCGTAATAATCTTTTTTATGGTAATACCGATCATGATTGGAGGCTTTGGAAACTGACTTATTCCGCTCATGATTGGGGCGCCCGACATGGCGTTCCCTCGAATAAATAATATGAGCTTTTGACTTCTTCCGCCTTCTTTCCTTCTACTGCTCGCCTCTTCTGGCGTTGAAGCAGGCGCAGGGACAGGGTGAACTGTCTATCCCCCACTAGCAGGTAACCTTGCTCACGCAGGGGCCTCCGTAGACCTAACAATTTTCTCCCTCCACCTCGCAGGGATCTCCTCTATTCTAGGGGCTATTAACTTCATCACAACTATTATTAATATGAAACCCCCTGCTATCTCCCAGTACCAAACACCTTTATTTGTGTGAGCTGTCCTAATTACAGCTGTCCTCCTTCTACTATCCCTGCCAGTTCTCGCTGCAGGAATTACGATGCTCCTTACCGACCGAAATCTTAATACTACATTCTTTGACCCGGCAGGAGGTGGAGATCCAATCCTTTACCAACACTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Rocha, L.A., Choat, J.H., Clements, K.D., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is widely distributed in the western North Atlantic, and is very common. There are no major threats known to this species and it occurs in a number of marine protected areas in parts of its distribution. It is therefore listed as Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common (L. Rocha pers comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range. Fisheries for parrotfishes are permanently closed in Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sparisoma aurofrenatum

Sparisoma aurofrenatum, common names the redband parrotfish, gutong, rainbow parrot, black parrot, and blisterside,[1] is a species of parrotfish.[2]

Description[edit]

This species grows to 28 cm.

Initial phase[edit]

During the initial phase, the colouration varies greatly from blue-green to green to solid olive. The fins are mottled brown to red and have two white stripes. Behind the dorsal fin, a white spot is present.[3]

Juvenile phase[edit]

The body of juvenile specimens are shades of red-brown. Normally, two white stripes will be visible with a black blotch present behind the upper gill covers. A white spot will also be present behind the dorsal fin.

During both the juvenile and initial phases, colouration and markings can change quickly.[3]

Terminal phase[edit]

The body becomes greenish during the terminal phase. The underside will appear lighter and the anal fin becomes reddish. The tail becomes more square-shaped with black outer tips. The upper portion of the forebody will display a small, yellow blotch with at least two small black dots.

Normally, an orangish-pink[4] colour band will be present starting from below the eye along to the corner of the mouth. A white spot will appear behind the dorsal fin.[3]

Distribution[edit]

This species occurs throughout the Caribbean Sea, and the western Atlantic Ocean in the waters of Bermuda, Florida, the Bahamas to Central America and Brazil.[5]

Habitat[edit]

Sparisoma aurofrenatum lives on reefs in depths of 2 to 20 metres.[5] The juveniles live among seagrass beds.[6]

Behaviour[edit]

Sparisoma aurofrenatum is solitary or found in small groups. It may found resting on the bottom. It is a protogynous hermaphrodite.[5]

While swimming about reefs, this fish will use only its pectoral fins. Only when requiring a sudden burst of speed will it use its tail.[3]

Specimens may be seen defecating frequently, which appears as a white cloud as it is mostly composed of coral limestone.[3]

Diet[edit]

Sparisoma aurofrenatum is a herbivore, feeding on algae and polyps it scrapes from rocks and coral using its 'beak'.[7]

References[edit]

  1. ^ a b "Sparisoma aurofrenatum (Black Parrot, Blisterside, Gutong, Rainbow Parrot, Redband Parrotfish)". Iucnredlist.org. 2009-09-15. Retrieved 2013-09-27. 
  2. ^ "WoRMS - World Register of Marine Species - Sparisoma aurofrenatum (Valenciennes, 1840)". Marinespecies.org. 2008-01-15. Retrieved 2013-09-27. 
  3. ^ a b c d e "Marine Species Identification Portal : Redband parrotfish - Sparisoma aurofrenatum". Species-identification.org. Retrieved 2013-09-27. 
  4. ^ "Sparisoma aurofrenatum - Redband parrotfish". Aquafind.com. Retrieved 2013-09-27. 
  5. ^ a b c [1][dead link]
  6. ^ "View Sparisoma aurofrenatum". Saltcorner.com. Retrieved 2013-09-27. 
  7. ^ "Smithsonian Tropical Research Institute-Sparisoma aurofrenatum". Biogeodb.stri.si.edu. Retrieved 2013-09-27. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!