Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The Pacific sleeper shark (Somniosus pacificus) is a secretive, deep-dwelling shark referred to by many fishermen as the “mud shark.” COLOR: Pacific sleeper sharks are uniformly dark gray to black with round fins and tail. Their eyes are small and black. SPEED: Sleeper sharks are generally sluggish and normally swim slowly. They probably rarely exceed speeds of a few miles per hour (5 km/hr).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found on continental shelves and slopes (Ref. 247). At high latitudes, it occurs in littoral and even intertidal areas; in lower latitudes it may never come to the surface and ranges down to at least 2,000 m (Ref. 247). Feeds on bottom animals such as fishes, octopi, squids, crabs and tritons; also harbor seals and carrion (Ref. 247). Ovoviviparous (Ref. 205), with 300 pups in a litter (Ref. 247), length at birth about 42 cm or less (Ref. 26346). The flesh contains a type of toxin which, when eaten, produces symptoms of drunkenness (Ref. 583). Possibly reaches lengths greater than 700 cm (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Northwest Pacific to northeast Pacific: Japan along the Kuril Islands, Sea of Okhotsk and Bering Sea (Russia) to the Chukchi Sea and southward to southern California (USA), and Baja California (Mexico) (Ebert, 2003). Also, recently found off Taiwan (Wang and Yang 2004). Its distribution above the Arctic Circle is unclear and may be misidentified with S. microcephalus. There are some records from off central Chile (Brito 2004) and Uruguay (de Asarloa et al. 1999), however these are probably misidentifications. Large sleeper sharks identified as this species from the southern hemisphere are most likely that of S. antarcticus (Ebert 2003).

Hulbert et al. (2006) studied the depth and movement behaviour of this species in the Northeast Pacific Ocean using electronic and numerical tagging. Most tags recovered (76%) were within 100 km of release locations, 16% were within 100–250 km and 8% were within 250–500 km.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific sleeper sharks are found in polar and sub-polar waters throughout the year. They occur in the Pacific Ocean from Baja California north to the Bering Sea, Chukchi Sea, Beaufort Sea, and to the Okhotsk Sea off of Japan. They inhabit cold, deep waters to depths exceeding 6500 feet (1981 m). At higher latitudes sleeper sharks use shallow as well as deep waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific and Arctic Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Pacific sleeper sharks have been caught that exceed 20 feet (6 m) in length, which would weigh in at about 8000 pounds (3600 kg). This is approaching the size of adult orcas.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

440 cm TL (male/unsexed; (Ref. 247)); 430 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Somniosus pacificus differs from S. antarcticus by the following characters: interdorsal space about 70% of prebranchial length (vs. 80%); height of first dorsal fin about 3.7% of precaudal length (PCL) (vs. 3.0%); height of second dorsal fin about 3.4% of PCL (vs. 2.9%); number of turns in spiral valve 32-37 (mode 33) (vs. 36-41, mode 39); precaudal vertebrae 28-30 (mode 29) (vs. 30-31, mode 30) (Ref. 50224).Description: Uniformly greyish-pink with bluish black fins; live specimens probably with white spots on dorsal surface (Ref. 6871). Short rounded snout, heavily cylindrical body and small precaudal fins, equal-sized dorsal fins, asymmetrical caudal fin with a well-developed ventral lobe (Ref. 6871), first dorsal fin on back closer to pelvic fins than pectoral fins, interdorsal space less than distance from snout tip to first gill openings, no short keels on base of caudal fin, upper teeth lanceolate, lower teeth with short, low, strongly oblique cusps and high narrow roots (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

The Pacific sleeper shark (Somniosus pacificus) is a secretive, deep-dwelling shark referred to by many fishermen as the “mud shark.” The Greenland shark is found in the North Atlantic Ocean and is a similar species. 

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A boreal and temperate shark found over continental shelves and slopes. At high latitudes with cold surface waters it ranges into the littoral and even the intertidal (one large individual was found trapped in a tide pool) as well as the surface; however in lower latitudes with temperate water it becomes a deep-water, epibenthic shark, never coming to the surface and ranging down to at least 2,000 m in the extreme southern end of its range (off southern California and Baja California) (Ebert 2003).

Archived depth data from recent tagging studies in the Northeast Pacific showed some sleeper sharks regularly ascended and descended at rates over 200 meters per hour, traveling below the photic zone during the day and approaching the surface at night (Hulbert et al. 2006).

Development is yolk-sac viviparity, but pregnant females have yet to be found, and for some reason are rare, as in the closely related Greenland shark (S. microcephalus). This is possibly due to segregation of pregnant females beyond the usual fisheries gear that capture these sharks or extremely low fecundity, with a small fraction of adult females pregnant at any one time. Although female sharks with ovaries containing over 300 large unfertilized eggs and many small undeveloped ova have been captured in trawls off Moss Landing and Trinidad, California (Gotshall and Jow 1965, Ebert et al. 1987). Size at birth is between 40–65 cm TL suggesting that fecundity may indeed be high for this species given the enormous size of the females. Neonates have been taken in midwater trawls indiciating that they occupy this habitat early in life before taking up a more demersal lifestyle (Ebert 2003).

Mature Pacific Sleeper Sharks have not been reported from the Bering Sea and Aleutian Islands or the Gulf of Alaska, but we know of observers who have seen very large Sleeper Sharks, but they are usually just discarded.

The species attains a maximum length of at least 440 cm with unconfirmed records of up to 700 cm total length (TL) or more (Ebert et al. 1987, Ebert 2003). Adult females are 370–430 cm TL and larger individuals estimated at 700 cm TL or more have been photographed in deep water (Ebert et al. 1987, Yano et al. 2007). Males are mature by at least 397 cm TL (Ebert et al. 1987).

These sharks feed on a wide variety of surface and bottom animals, including flatfish, Pacific salmon, rockfish, harbor seals, octopi, squid, crabs, tritons, and carrion. It is not known if seals and fast-swimming pelagic fish such as salmon are captured alive by these lumbering, sluggish sharks or are picked up as carrion. The small mouths and long heads and oral cavities of these sharks suggest that they are powerful suction feeders, but this has yet to be observed. Pacific sleeper sharks commonly are attracted to traps set at great depths for sablefish (Anoplopoma fimbria), and get trapped themselves or else eat catch and bait-can and escape (Ebert 2003, Ebert et al. 1987).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific sleeper sharks use the ocean bottom for resting and to feed on fish and large, sunken prey such as dead whales. At night they come to the surface to feed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; marine; depth range 0 - 2000 m (Ref. 26346)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 589.09 - 963
  Temperature range (°C): 2.943 - 7.717
  Nitrate (umol/L): 24.124 - 43.857
  Salinity (PPS): 34.287 - 34.536
  Oxygen (ml/l): 0.303 - 4.597
  Phosphate (umol/l): 1.506 - 3.251
  Silicate (umol/l): 14.707 - 146.449

Graphical representation

Depth range (m): 589.09 - 963

Temperature range (°C): 2.943 - 7.717

Nitrate (umol/L): 24.124 - 43.857

Salinity (PPS): 34.287 - 34.536

Oxygen (ml/l): 0.303 - 4.597

Phosphate (umol/l): 1.506 - 3.251

Silicate (umol/l): 14.707 - 146.449
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 2000m.
Recorded at 2000 meters.

Habitat: benthopelagic. Found on continental shelves and slopes. Occurs in littoral and even intertidal areas at high latitudes, however, in lower latitudes it may never come to the surface and ranges down to at least 2000 m. Feeds on bottom animals such as flatfishes, Pacific salmon, rockfishes, harbor seals, octopi, squids, crabs, tritons, and carrion. The flesh contains a type of toxin which, when eaten, produces symptoms of drunkeness (Ref. 583). Possibly to 700 cm in length.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whale-Fall Communities

 The species associated with this article are major components of the successionary communities arising around bathyal whale carcasses (though by no means the only whale-fall associated species).

A whale carcass arriving on the bathyal sea-floor (roughly 700-1000m depth) represents a massive influx of nutrients to an otherwise nutrient-poor ecosystem (Lundsten et al 2010a; Lundsten et al 2010b; Smith and Baco 2003). The background rate of carbon deposition to the deep-sea floor is on the order of tens of kilograms per hectare per year (Smith and Baco 2003); an adult whale can weigh up to 160 tons. Consequently, it has long been thought that whale carcasses must represent a significant source of nutrients for sea-bed communities. Additionally, since the discovery of deep-sea hydrothermal vents and cold seeps, it has been hypothesized that whale-falls may serve as stepping stones for the dispersal of organisms between chemosynthesis-dominated bottom communities (Smith and Baco 2003). 

The community observed to spring up around whale carcasses has been characterized as having three major successionary stages (Danise et al 2012):

-Mobile scavenger stage: large, mobile detritivores consume the flesh of the whale. 

-Enrichment opportunist stage: slow-moving or sessile organisms colonize the nutrient-enriched area in and around the carcass.

-Sulphophilic stage: a chemosynthesis-dominated system based on the sulfides released by anaerobic decomposition of bone lipids.

The duration of the first stage depends largely on the mass of the whale, ranging from a few months to up to one and a half years. Initially the community is dominated by large detritivores such as sleeper sharks and hagfish, but as the amount of flesh available decreases, smaller scavengers such as rattails, amphipods, and and lithodid crabs begin to replace them. Once the bulk of the tissue is removed from the skeleton, the community begins to shift to phase two. At this point, extremely dense populations of dorvilleid worms and other polychaetes, as well as crustaceans and gastropods colonize the area around the carcass, exploiting the rich organic material in the surrounding sediments. The rapid recruitment of these organisms suggests they may be opportunistic whale-fall specialists. Over time, without a discrete boundary, sulphide emission from anaerobic decay of bone lipids in the whale skeleton begins to support a chemosynthetic fauna similar to that found around cold seeps and hydrothermal vents, including bacteria, organisms with endosymbiotic bacteria, bacterial grazers, and small predators. This community may linger for up to several decades (Smith and Baco 2003). Fossil evidence suggests that a similar pattern of succession has been evolving since the late Miocene, and may even have operated on the carcasses of Cretaceous plesiosaurs (Danise et al 2012). 

As always in ecology, this picture is somewhat oversimplified. In two 2010 articles, Lundsten et al observe that in addition to chemosynthetic fauna and whale-fall specialists, whale carcasses are often characterized by increased density of the background sea-floor organisms, particularly as time passes since the fall of the whale. Lundsten et al and Glover (2010) additionally found that there is a notable depth gradient in community structure, with fully sulphophilic ecosystems only developing on large, deep carcasses.

The function of whale-falls as stepping stones between cold seeps and hydrothermal vents remains unproven, but there is evidence for relatively large numbers of whale-fall specialist species, especially in the enrichment opportunist and sulphophilic stages (Smith and Baco 2003). Nearest-neighbor analyses of whale falls based on whale populations and the probability of a carcass sinking suggest that carcasses are distributed such that most organisms found in the latter two stages could easily disperse larvae between whale-fall sites. Unfortunately, this ecosystem may be endangered by declining whale populations and may even have already lost a great deal of diversity, as 19th century whale-fall density was likely up to six times higher than that in the present day (Smith and Baco 2003). 

  • Danise S, Cavalazzi B, Dominici S, Westall F, Monechi S, Guioli S. 2012. Evidence of microbial activity from a shallow water whale fall (Voghera, northern Italy). Paleogeography, Paleoclimatology, Paleoecology. 317-318: 13-26.
  • Glover AG, Higgs ND, Bagley PM, Carlsson R, Davies AJ, Kemp KM, Last KS, Norling K, Rosenberg R, Wallin KA, Kallstrom B, Dahlgren TG. 2010. A live video observatory reveals temporal processes at a shelf-depth whale-fall. Cahiers de Biologie Marine. 51:375-381.
  • Lundsten L, Paull CK, Schlining KL, McGann M, Ussler III W. 2010. Biological characterization of a whale-fall near Vancouver Island, British Columbia, Canada. Deep-Sea Research I, 57:918-922.
  • Lundsten L, Schlining KL, Frasier K, Johnson SB, Kuhnz LA, Harvey JBJ, Clague G, Vrijenhoek RC. 2010. Deep-Sea Research I, 57:1573-1584.
  • Smith CR and Baco AR. 2003. Ecology of whale falls at the deep-sea floor. Oceanography and Marine Biology: an Annual Review. 41:311-354.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Satellite tags have been attached to Pacific sleeper sharks to determine their movements. Tag data indicates that individual sharks moved from the bottom, 2000 feet (610 m) deep, to the surface each night, apparently to feed. The limited tag data indicate that they did not migrate to other areas.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pacific sleeper sharks have a huge gut capacity and can fill it with copious amounts of food. Of 33 sleeper sharks sampled on an International Pacific Halibut Commission survey, five of the sharks had empty stomachs and 28 contained prey including salmon, squid, cod, pollock, squid and octopus beaks, harbor seal and other marine mammal tissue. One shark had nine adult pre-spawning chum salmon in its stomach. Sleeper sharks have been documented feeding on orca-killed whales, gorging themselves on blubber and flesh.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on the continental slope (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

CURRENT STATUS: Pacific sleeper shark numbers increased dramatically in the North Pacific during the 1980s and 1990s. In areas where few sharks ever were caught before, now fishermen are catching many more sleeper sharks. Many fishermen are reporting more and larger sharks each year in the Gulf of Alaska.

ECOLOGY/CONSERVATION: During the 1970s, temperatures in the North Pacific Ocean increased, followed by a change in species composition in the region. The ecosystem supported great quantities of shrimp and crab before the 1970s, but these species nearly disappeared and were replaced by pollock, cod, halibut and arrowtooth flounder. This species composition change is referred to as a “regime shift.” Other noteworthy and dramatic changes included decreases in sea lions, seals and forage fish (capelin, sandlance and herring) and increases in salmon sharks and Pacific sleeper sharks.

One theory explaining the regime shift involves increased winds, global warming, the Gobi Desert, iron and a group of phytoplankton (small single-celled plants) called “diatoms.” As the Earth warms due to global warming, scientists predicted, and have seen, stronger and more persistent winds. When these winds are especially strong they can sweep across the Gobi Desert of Mongolia carrying tons of dust laden with the element iron. Much of this iron is deposited in the North Pacific Ocean, which promotes the growth of a class of organisms called diatoms. Diatoms are single celled plants and can grow rapidly if the conditions are right. The diatoms use iron in a process that keeps them near the water’s surface and in the euphotic zone where they capture the sun’s energy. When the iron supply is used up, the diatoms sink to the bottom of the ocean. If there is lots of iron and it comes in a steady supply, the diatom population blooms and diatoms stay near the surface of the ocean and promote the surface food web and ecosystem. But if the winds are sporadic the diatoms grow, but soon deplete the iron in the water and sink to the bottom. This may be better for the ocean floor food web and ecosystem. The regime shift of the late 1970s may have been a result of the processes described here. As global warming changes wind patterns and the strength of the wind, we can expect more regime shifts and ones of greater magnitude.

Another theory of reduced marine mammal populations is that great white sharks have become abundant in Alaskan waters. Sharks are secretive by nature and do not readily reveal their presence, making it difficult for scientists to study. Sleeper shark populations are at record highs in the North Pacific, and they are preying on many species of fish and on some marine mammals. Sharks may be exerting an influence on the North Pacific marine ecosystem that will be long-lasting. Some scientists and many fishermen are concerned about what will happen, now that sharks are so common in the North Pacific Ocean. Many people have proposed shark predator-control programs without understanding the consequences.

Mathematical ecosystem models predict that there may be worse consequences if people reduce the shark population than there will be if they do not. Though sharks compete for some of the fish people catch and eat, sharks also reduce large changes in prey population numbers. According to some population models, removing sharks likely will result in increased salmon, black cod and pollock numbers. The increase in these smaller predatory fish would increase predation on smaller but extremely important forage fish such as herring, capelin and sandlance. The predicted outcome of the subsequent declines of the forage fish is for further reductions of seal and sea lion populations. This would be bad for fishermen. It also would be a big concern for those people trying to bring the sea lion back from the brink of extinction.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Deep underwater video has captured many Pacific sleeper sharks feeding together on whale carcasses. The sharks appear to be non-aggressive towards each other as they feed. No information is available on other sleeper shark social interactions.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Probably ovoviviparous (Ref. 247). Size at birth 42 cm or less (Ref. 26346). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Pacific sleeper sharks probably live more than 40 years. This age estimate is based upon the size this species obtains and upon the average growth rates. Determining the age of sharks is problematic. Bony fish can be aged by counting the annual rings on a bone in the ear called an otolith; most sharks do not have any bones and no shark has an otolith.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There is little information on Pacific sleeper shark reproduction. Only recently have scientists  learned that sleeper sharks bear live young.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Pacific sleeper sharks are designed for stealth. Their eyesight is probably poor, but good eyesight is not necessary since they have an exceptional “sixth sense" to detect very slight electromagnetic fields. Muscle activity, even the beating of an animal’s heart or the movement of its diaphragm, emits an electrical signal that the sharks use to detect, locate and attack their victims. Under cover of darkness prey would be less likely to detect a sleeper shark coming up from the depths. Prey emits electromagnetic signals that guide the shark right in. For sleeper sharks, darkness is not a deterrent to detecting prey, but instead a cover or camouflage.

Pacific sleeper shark teeth are quite different in the lower jaw compared to the upper jaw. The upper jaw has small, sharp, conical teeth much like those in halibut. These are used to seize and hold prey. The teeth in the lower jaw are interlocking, forming a serrated blade used for slicing. Sleeper shark bite marks resemble large three-quarter moons or slices.

Sleeper sharks attack suddenly and without warning. A harbor seal might be floating on the surface of the ocean trying to catch its breath when it is attacked from below by a 400-pound (181-kg) sleeper shark. A bite to its midsection and the seal is eviscerated and struggling for its life. At minimum, the shark gets a large chunk of skin and blubber, likely enough to cause the seal soon to die. However the shark will finish the job by ripping the seal to bits, eating and digesting the entire animal. Smaller animals such as adult chum salmon or black cod usually are eaten whole.

Halibut and black cod struggling on a fisherman’s long line (bottom-set line with hundreds of baited hooks) attract sleeper sharks. The struggling fish emit signals that the sharks can detect from long distances. The sleeper sharks bite chunks out of the halibut. When sharks try to eat the cod whole, the same hook that caught the cod may hook the sharks. The struggling sleeper sharks tangle and damage commercial fishing gear, forcing many fishermen to change fishing areas.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Somniosus pacificus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATCTTTGGTGCCTGAGCAGGGATAGTAGGCACAGCCCTGAGTTTACTTATTCGAACAGAATTAAGCCAACCAGGAACACTTCTAGGAGATGATCAAATCTACAATGTTATTGTTACTGCTCACGCTTTCGTAATAATCTTTTTTATAGTAATGCCTGTAATAATTGGCGGGTTCGGAAATTGATTAGTCCCTCTAATAATTGGCGCACCCGACATAGCTTTCCCGCGAATAAATAACATAAGCTTTTGATTACTCCCCCCCTCTCTCCTGCTACTTTTAGCCTCTGCCGGGGTTGAAGCAGGAGCCGGAACCGGCTGAACGGTCTATCCCCCCCTTGCAGGTAATATAGCCCACGCCGGCGCATCCGTAGACTTAGCCATCTTCTCACTCCACTTGGCTGGTATTTCATCAATTTTAGCCTCTGTTAACTTCATCACAACTATTATTAATATAAAACCACCTGCCATTTCTCAATATCAAACACCACTATTTGTCTGATCCATCCTTGTAACTACAGTCCTCCTACTCCTTTCCCTTCCTGTTCTTGCAGCTGCAATCACAATACTATTAACCGACCGTAATTTAAACACAACATTTTTTGACCCTGCTGGAGGAGGAGACCCAATTCTCTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Somniosus pacificus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Ebert, D.A., Goldman, K.J. & Orlov, A.M.

Reviewer/s
Valenti, S.V., Musick, J. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
The Pacific Sleeper Shark (Somniosus pacificus) is a deepwater sleeper shark, relatively common in the north Pacific Ocean. Records from the southern hemisphere are most likely Somniosus antarcticus. In the northern part of its distribution it ranges into shallower water, but at lower latitudes it becomes strictly deepwater, extending down to at least 2,000 m depth in the extreme southern end of its range. The species is taken as bycatch by bottom trawl fisheries in the western Bering Sea, and by longline fisheries for sablefish and Pacific halibut in the eastern north Pacific, and is generally discarded. Biomass estimates are increasing in the western Bering Sea and Gulf of Alaska, and have decreased in other areas in the eastern Pacific. Greater depths that are not currently fished may provide some refuge for adult Pacific sleeper sharks. The lack of life history data (e.g. growth rates and fecundity) and robust population assessment information provide justification for a Data Deficient listing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Biomass estimates are available from the results of bottom trawl surveys in the Bering Sea, off the Aleutians and Gulf of Alaska no deeper than 1,000 m (i.e., within upper part of species' bathymetric range, where mainly juvenile Pacific sleeper sharks occur). In Alaska, sharks of 1.5–2.5 m are most common (e.g., Sigler et al. 2006) and sharks as large as 4.3 m have been caught (Orlov 1999). Data from the Gulf of Alaska and eastern Bering Sea are not robust enough to make statement about population numbers or changes in actual population size. The short-term fluctuations in biomass trend data presented herein are too large to represent trends in overall shark population biomass, but may be a result of sampling vagaries and/or population movements (i.e. changes in local density) rather than actual changes in population size, and could indicate changes in catchability.

Biomass apparently increased in the western Bering Sea from 1,170 mt in 1999 to 87,500 mt in 2002 (Glebov et al. 2003). On the eastern Bering Sea shelf, Pacific sleeper sharks were not well documented in survey catch until the mid-1990s. Biomass in 1999 was estimated at 2,079 mt and increased to 5,602 mt in 2002. However, biomass estimates have decreased since then and were down to 2,944 mt in 2006 (Heifetz et al. 2007).

On the slope of the eastern Bering Sea no Pacific sleeper sharks were recorded in 1979 or 1981. In 1982 biomass was estimated at 12 mt and increased steadily through 1991 when the estimate was 1,235 mt. A new slope survey initiated in 2002 showed a very large biomass of sleeper sharks (25,445 mt in 2002, but dramatically decreased down to 2,260 mt in 2004 (Heifetz et al. 2007).

No Pacific Sleeper Sharks were caught off the Aleutians in 1980. In 1983 biomass constituted about 254 mt. Biomass estimates slowly increased through 1991 when biomass was estimated to be 2,927 mt, but then sharply decreased in 1994 to just over 373 mt. Biomass estimates fluctuated from 1997 through 2004 with the highest biomass estimate being 2,638 mt in 2000 and the lowest estimate being 536 mt in 2002. The 2005 biomass estimate increased to 1,017 mt, and subsequently decreased down to 76 mt in 2006 (Heifetz et al. 2007). However, as previously stated above, large short-term biomass fluctuations may be a result of sampling vagaries and/or population movements (i.e. changes in local density) rather than actual changes in population size.

In the Gulf of Alaska biomass in 1984 was estimated as 163 mt. Since then it demonstrates gradual upward trend and reached 57,022 mt in 2005 (Courtney et al. 2006b).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is taken as bycatch in several fisheries and usually discarded. It is notably affected by bottom trawl fisheries in the western Bering Sea (Orlov 2005), by longline fisheries for sablefish and Pacific halibut in the eastern North Pacific (Courtney et al. 2006a, b). Incidental catch in US waters in 2006 was 435 mt, in some years it has reached ~ 1,400 mt (Courtney et al. 2006a, b).

From 1997–2001 in the Bering Sea Aleutian Islands area, Pacific sleeper sharks were caught primarily by the Pacific cod longline fishery (30%), walleye pollock pelagic trawl fishery (26%), Greenland turbot longline fishery (17%), flatfish trawl fishery (12%), and sablefish longline fishery (10%). From 1997–2002 in the Bering Sea Aleutian Islands area, Pacific sleeper sharks were caught primarily in two statistical areas, which made up 57% and 20% of the total sleeper shark catch. There has been an increasing trend in catch of Pacific sleeper sharks from two statistical areas in the eastern Bering Sea between 1997-2002, however, this may reflect a change in fishing effort as opposed to any increase in the population size.

Fisheries in the western Bering Sea catch mainly juveniles of this species, present at shallower depths than adults. Greater depths that are not currently fished may provide some refuge for adult Pacific sleeper sharks, however the situation should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific sleeper shark tissue is reported to be toxic to people and other animals. They are probably only preyed upon by other sharks. Commercial fishermen regularly kill Pacific sleeper sharks that they catch while fishing for black cod and halibut.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Bruce Wright

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No current conservation measures are known.

Like many deeper water species more information on biology, ecology and importance in fisheries are required to further assess status and any future conservation needs. Where taken, catches require close monitoring.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and management of all chondrichthyan species in the region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific sleeper shark

The Pacific sleeper shark, Somniosus pacificus, is a sleeper shark of the family Somniosidae, found circumglobally on continental shelves and slopes in temperate waters between latitudes 70°N and 22°N, from the surface to 2,000 metres (6,600 ft). Its length is up to 4.4 m (14 ft), although FishBase accepts that it could possibly reach lengths in excess of 7 m (23 ft).

Feeding habits[edit]

Pacific sleeper sharks, which are also known scavengers, can glide through the water with little body movement and little hydrodynamic noise making them successful predators. They feed by suction and cutting of their prey. They have large mouths that can inhale prey and their teeth cut up any pieces that are too large to swallow. They show a characteristic rolling motion of the head when feeding. Only in Alaska has the shark’s diet been studied - most sharks' stomachs contain remains of giant Pacific octopus. They are also known to feed on bottom-dwelling teleost fishes as well as soles, flounders, pollocks, rockfishes, shrimps, hermit crabs, and even marine snails. Larger Pacific sleeper sharks are also found to feed on fast swimming prey such as squids, Pacific salmon, and harbor porpoises. The diet of the Pacific sleeper shark seems to broaden as they increase in size. For example, a 3.7 m female shark found off Trinidad, California was found to have fed mostly on giant squid. Sleeper sharks found in Alaskan waters from 2 to 3 m (6.6 to 9.8 ft) seem to feed mostly on flounder, pollock, and cephalopods, while sleeper sharks 3.3 to 4.25 m (10.8 to 13.9 ft) long seem to consume teleosts and cephalopods, as well as marine mammals.

Reproduction[edit]

There is very little known about the early life of Pacific sleeper sharks. Pacific sleeper sharks are believed to produce eggs that hatch inside the female’s body (reproduction is ovoviviparous), but gestation time is unknown and litter sizes are thought to be about 10 pups. Its length at birth is approximately 42 cm (1.38 ft) or less.[2]

Size[edit]

Pacific sleeper sharks are reported to reach lengths of up to 25 feet. The average mature size is 3.65 m (12.0 ft) and 318–363 kg (701–800 lb). The largest Pacific sleeper shark verified in size measured 4.4 m (14 ft) long and weighed 888 kg (1,958 lb), although FishBase accepts that it could possibly reach 7 m or more.[3] In 1989, an enormous Pacific sleeper shark was attracted to a bait in deep water outside Tokyo Bay, Japan and filmed. The shark was estimated by Eugenie Clark to be about 7 m (23 ft) long.[2]

Adaptations[edit]

Due to living in frigid depths the sleeper shark's liver oil contains no squalene because it would solidify into a dense, non-buoyant mass. Rather than squalene, the low-density compounds in the sharks' liver are diacylglyceryl ethers (DAGE) and triacylglycerol (TAG) which maintain their fluidity even at the lowest temperatures. Also, they store very little urea in their skin (like many deep sea sharks) but store high concentrations of trimethylamine oxide (a nitrogenous waste product). This helps the sleeper shark stabilize proteins that make up swimming muscles, digestive and reproductive hormones against the crushing pressure and intense cold of the deep sea. Because food is relatively scarce on the deep sea floor the sleeper shark is able to store food in its capacious stomach. The sleeper shark’s jaws are able to produce a powerful bite due to their short and transverse shape. The upper jaw teeth of the sleeper shark are spike-like, while the lower jaw teeth are oblique cusps and overlapping bases. This arrangement allows grasping and sawing of food too large to swallow. Pacific sleeper sharks have a short caudal fin which allows them to store energy for fast and violent bursts of energy to catch prey.[2]

Known predators[edit]

Sleeper sharks are preyed upon by the offshore eco-type of killer whales off British Columbia.[4]

See also[edit]

References[edit]

  1. ^ D. A. Ebert, K. J. Goldman & A. M. Orlov (2008). "Somniosus pacificus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 6, 2010. 
  2. ^ a b c Martin, R. Aidan. "Elasmo Research". ReefQuest. Retrieved 6 May 2009. 
  3. ^ Castro, José I., The Sharks of North America. Oxford University Press (2011), ISBN 978-0-19-539294-4
  4. ^ Keven Drews, The Canadian Press. "Killer whales feast on sharks off B.C. coast". The Canadian Press. Retrieved 5 Sep 2011. 
General references
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!