Overview

Comprehensive Description

Biology

Occur in inshore oceanic waters often associated with reefs, jetties and pylons (Ref. 6390), sometimes entering estuaries (Ref. 9563). Prefer warmer water (18-24°C) although they are occasionally found in cooler water (Ref. 27128).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: endemic to Australia (Ref. 7300), Norfolk Island and New Zealand (Ref. 8879).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Pacific and southeastern Indian Ocean off Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 9563)); max. published weight: 53.1 kg (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 60.5 - 60.5
  Temperature range (°C): 17.702 - 17.702
  Nitrate (umol/L): 0.224 - 0.224
  Salinity (PPS): 35.812 - 35.812
  Oxygen (ml/l): 5.352 - 5.352
  Phosphate (umol/l): 0.137 - 0.137
  Silicate (umol/l): 1.500 - 1.500
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur in inshore oceanic waters often associated with reefs, jetties and pylons (Ref. 6390), sometimes entering estuaries (Ref. 9563). Prefer warmer water (18-24°C) although they are occasionally found in cooler water (Ref. 27128).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Seriola hippos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATNTAGTATTTGGTGCCTGAGCCGGCATGGTCGGTACAGCCTTAAGCTTACTCATCCGAGCAGAACTAAGTCAACCTGGTGCTCTTCTGGGGGACGACCAGATTTATAACGTAATCGTTACAGCGCACGCGTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGGAACTGACTCATCCCTTTAATGATCGGAGCTCCCGATATAGCATTCCCCCGAATAAACAATATGAGCTTCTGACTCCTCCCCCCTTCGTTCCTCCTGCTTCTAGCCTCTTCAGGCGTTGAAGCCGGGGCTGGAACGGGTTGAACAGTCTACCCGCCTCTAGCGGGTAACCTTGCCCACGCGGGAGCATCCGTAGACTTAACAATTTTCTCCCTTCACTTAGCTGGGATCTCCTCAATTCTAGGGGCCATTAACTTTATCACAACCATCATCAACATGAAACCCCATGCTGTCTCCATGTACCAAATTCCCCTATTTGTCTGAGCTGTCCTAATTACGGCCGTACTCTTGCTCCTATCACTCCCAGTCCTAGCCGCCGGCATTACGATGCTTCTAACAGACCGAAACTTAAACACTGCCTTCTTTGACCCAGCCGGAGGGGGAGATCCCATCCTTTACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Seriola hippos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Samson fish

The samson fish (Seriola hippos) is a jack of the genus Seriola. It is found in the Indo-Pacific Oceans to eastern Northland in New Zealand. Its length is between 80 and 150 cm.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!