Overview

Comprehensive Description

Biology

Adults occur in inshore oceanic waters often associated with reefs, jetties and pylons (Ref. 6390), sometimes entering estuaries (Ref. 9563). They Prefer warmer water (18-24°C) although they are occasionally found in cooler water (Ref. 27128).
  • Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley 1989 Pisces. Petromyzontidae to Carangidae. Zoological Catalogue of Australia, Vol. 7. Australian Government Publishing Service, Canberra, 665 p. (Ref. 7300)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: endemic to Australia (Ref. 7300), Norfolk Island and New Zealand (Ref. 8879).
  • Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley 1989 Pisces. Petromyzontidae to Carangidae. Zoological Catalogue of Australia, Vol. 7. Australian Government Publishing Service, Canberra, 665 p. (Ref. 7300)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Pacific and southeastern Indian Ocean off Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 9563)); max. published weight: 53.1 kg (Ref. 6390)
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
  • May, J.L. and J.G.H. Maxwell 1986 Trawl fish from temperate waters of Australia. CSIRO Division of Fisheries Research, Tasmania. 492 p. (Ref. 9563)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 60.5 - 60.5
  Temperature range (°C): 17.702 - 17.702
  Nitrate (umol/L): 0.224 - 0.224
  Salinity (PPS): 35.812 - 35.812
  Oxygen (ml/l): 5.352 - 5.352
  Phosphate (umol/l): 0.137 - 0.137
  Silicate (umol/l): 1.500 - 1.500
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur in inshore oceanic waters often associated with reefs, jetties and pylons (Ref. 6390), sometimes entering estuaries (Ref. 9563). Prefer warmer water (18-24°C) although they are occasionally found in cooler water (Ref. 27128).
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Seriola hippos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATNTAGTATTTGGTGCCTGAGCCGGCATGGTCGGTACAGCCTTAAGCTTACTCATCCGAGCAGAACTAAGTCAACCTGGTGCTCTTCTGGGGGACGACCAGATTTATAACGTAATCGTTACAGCGCACGCGTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGGAACTGACTCATCCCTTTAATGATCGGAGCTCCCGATATAGCATTCCCCCGAATAAACAATATGAGCTTCTGACTCCTCCCCCCTTCGTTCCTCCTGCTTCTAGCCTCTTCAGGCGTTGAAGCCGGGGCTGGAACGGGTTGAACAGTCTACCCGCCTCTAGCGGGTAACCTTGCCCACGCGGGAGCATCCGTAGACTTAACAATTTTCTCCCTTCACTTAGCTGGGATCTCCTCAATTCTAGGGGCCATTAACTTTATCACAACCATCATCAACATGAAACCCCATGCTGTCTCCATGTACCAAATTCCCCTATTTGTCTGAGCTGTCCTAATTACGGCCGTACTCTTGCTCCTATCACTCCCAGTCCTAGCCGCCGGCATTACGATGCTTCTAACAGACCGAAACTTAAACACTGCCTTCTTTGACCCAGCCGGAGGGGGAGATCCCATCCTTTACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Seriola hippos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Samson fish

The samson fish (Seriola hippos) is a jack of the genus Seriola. It is found in the Indo-Pacific Oceans to eastern Northland in New Zealand. Its length is between 80 and 150 cm.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!