Overview

Comprehensive Description

Biology

Adults found over rocky reefs, but also common on open bottoms to about 320 m (Ref. 2850). Juveniles are pelagic and settle in near shore nursery areas, then move to deeper habitats (Ref. 36715). Young form schools (Ref. 2850). Feed mainly on fishes, including other rockfishes (Ref. 2850). Ovoviviparous, with planktonic larvae (Ref. 36715, 6885, 34817). Validated age by radiometry is 37 yrs (Ref. 75794). A famous sport fish throughout its range (Ref. 2850). Flesh is of excellent quality when kept chilled (Ref. 27436). Sold with other rockfish species (Ref. 27436).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Coastal waters of the Pacific Ocean, from Alaska to Baja California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Stepovak Bay, Alaskan Peninsula to Punta Blanca, Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 15; Dorsal soft rays (total): 13 - 16; Analspines: 3; Analsoft rays: 8 - 10; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 9,630 g (Ref. 4690); max. reported age: 50 years (Ref. 75794)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A large rockfish with weak head spines - nasal and parietal spines usually absent, preocular, supraocular, postocular, tympanic, coronal and nuchal spines absent (Ref. 27437). Lower jaw long, thickened, with no real symphyseal knob and projects past upper jaw; maxillary extends to behind the eye; parietal ridges parallel (Ref. 27437). Caudal slightly indented (Ref. 6885). Olive orange to burnt orange or brown in color (Ref. 27437). Branchiostegal rays: 7 (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Adults often occur in rocky areas, at depths of 12-481 m (most abundant at 50-251 m); larvae and small juveniles are pelagic and commonly occur in the upper 90 m of the water column; juveniles sometimes form dense schools under drifting kelp mats (NMFS 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Reef-associated species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 476 m (Ref. 27437)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 315 specimens in 1 taxon.
Water temperature and chemistry ranges based on 154 samples.

Environmental ranges
  Depth range (m): 3.66 - 406.26
  Temperature range (°C): 6.155 - 8.018
  Nitrate (umol/L): 11.539 - 32.802
  Salinity (PPS): 32.340 - 33.945
  Oxygen (ml/l): 2.388 - 6.547
  Phosphate (umol/l): 1.297 - 2.595
  Silicate (umol/l): 19.241 - 53.307

Graphical representation

Depth range (m): 3.66 - 406.26

Temperature range (°C): 6.155 - 8.018

Nitrate (umol/L): 11.539 - 32.802

Salinity (PPS): 32.340 - 33.945

Oxygen (ml/l): 2.388 - 6.547

Phosphate (umol/l): 1.297 - 2.595

Silicate (umol/l): 19.241 - 53.307
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 476m.
Recorded at 476 meters.

Habitat: reef-associated. Adults occur over rocky reefs but also common on open bottom from 27-320 m depth. Young live in shallower water. Young form schools and are caught more frequently, especially in rocky areas. Feeds mainly on fishes, including other rockfishes. Ovoviviparous, may produce as much as 2,300,000 young in a batch (Ref. 6885). A famous sport fish throughout its range. Its spines are venomous.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Eaten by marine mammals; juveniles sometimes are important in the diets of sea birds (NMFS 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous (Ref. 6885, 37177).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild) Observations: Some estimates suggest these animals may live up to 36-50 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Copulates generally in late summer and early fall; females bear live young in winter; off California, some females produce multiple broods in one season; juveniles grow rapidly but take 5 years to mature; may live up to 40 years; mean generation time is 12 years (see NMFS 2002). Large old fish may contribute most importantly to reproductive success (Garrison 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes paucispinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCACTAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAATCCCCCTAATGATCGGGGCCCCAGATATAGCATTTCCTCGTATGAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTACTACTACTTGCCTCTTCTGGGGTAGAAGCGGGTGCCGGGACCGGATGAACAGTATACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCTCTTCACCTAGCAGGTATCTCCTCAATCCTTGGGGCAATTAATTTTATTACCACAATTATTAATATGAAACCCCCGGCCATCTCCCAATACCAGACACCCCTATTCGTGTGAGCCGTCCTAATCACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATACTCCTCACTGACCGTAATCTTAATACCACCTTCTTTGACCCGGCTGGGGGTGGGGATCCAATTCTTTACCAACACTTATTCTGGTTTTTTGGACACCCCGAAGTATATATTCTTATTTTACCCGGCTTTGGTATGATTTCACACATTGTCGCCTATTACTCTGGCAAGAAAGAGCCCTTTGGCTACATGGGAATAGTATGGGCAATAATGGCCATTGGTCTTCTAGGCTTTATTGTATGAGCTCACCACATGTTCACAGTCGGCATGGACGTAGACACGCGTGCTTATTTTACATCTGCCACAATAATCATCGCAATTCCCACCGGTGTTAAAGTATTTAGCTGACTTGCAACCCTTCACGGGGGCTCCATTAAATGAGAGACACCCCTCTTGTGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTGGCCAACTCATCTCTAGATATTGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACGTATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes paucispinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 50
Specimens with Barcodes: 51
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1abd+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sobel, J.

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Long Term Trend: Decline of >90%

Comments: Recruitment is highly variable, has exceeded losses of adults in only 26 percent of years; no large recruitments have occurred since 1978; as a result, abundance fluctuates greatly (NMFS 2002). Since 1969, there has been a gradual decline in abundance to the current level of 3.6 percent of estimated unfished abundance (NMFS 2002).

On the west coast of Vancouver Island, British Columbia, abundance apparently declined by over 95% in the past 20-30 years and 90% in the past 10 years; the trend is uncertain elsewhere in British Columbia waters (Stanley et al. 2002). The trend since 1995 has been relatively stable (Stanley et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Evidently has declined primarily as a result of overutilization by fisheries targeting bocaccio and as bycatch in other fisheries (NMFS 2002). NMFS (2002) summarized recent fishery management aimed at reducing this threat and allowing the stock to recover.

Habitat likely has been degraded by commercial trawling, but this type of trawling has now been excluded from primary bocaccio habitat (NMFS 2002).

Protracted, warm ocean conditions in the 1990s were associated with poor recruitment and undoubtedly contributed to the decline in abundance (NMFS 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critically Endangered (CR) (A1abd+2d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: This species has been an important component of commercial and recreational catches off California for several decades (NMFS 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bocaccio rockfish

The Bocaccio, Sebastes paucispinis, is a member of the Sebastidae (rockfish) family. Other names for this species include salmon grouper, grouper, tom cod (juveniles), and slimy[citation needed]. In Greek, sebastes means “magnificent,” and paucispinis is Latin for “few spines”.[2]

Distribution and biology[edit]

Bocaccio can be found from Stepovak Bay, Alaska to central Baja California, but is mostly abundant from Oregon to northern Baja California. They have been spotted from various depths from the surface to 1,568 feet (478 m); most live between 150–1,000 feet (46–305 m).[2] Juveniles stay in shallower water because of the protection provided by floating kelp mats or driftwood. Shallow water kelp forests and oil platforms also help these fish avoid danger, as they can use them to dodge and hide from predators. As the fish get older, they to move into deeper, colder water. The Monterey submarine canyon is an ideal place for many marine organisms to inhabit or migrate through, and bocaccio in this canyon can consume multiple marine species such as shellfish (pelagic shrimp and crab), anchovies, sardines, other small rockfishes, and squid.

The bocaccio is one of the larger rockfish and can grow up to 3 feet (0.91 m) in length and live to 45 years. A bocaccio that is 12 inches (300 mm) long is around 3–4 years old and a 2-foot (0.61 m) long fish is 7–8 years old.[3] Females grow faster than males and also live longer. There is a difference in maturity rates from north to south. Southern California bocaccio mature at 14 inches and reproduce at around 18 inches (460 mm), while northern males mature at 22 inches and females at 24 inches. They are viviparous rockfish; in Southern California they spawn their larvae in 2 more batches and spawning occurs almost all year. In Central and Northern California they spawn from January to May, while further north spawning is restricted to January to March. One female can produce over 2 million eggs per season. Coloration is olive-brown dorsally becoming pink to red ventrally.[4]

Environmental effects[edit]

Certain effects of strong and weak upwelling affect the bocaccio’s food sources and the survival of its larvae. Larval rockfish are abundant in or near front upwelling fronts.[5] When the water is cold the upwelling is strong with more productivity and warmer water produces a weaker upwelling with a low amount of resources. Also, a weak upwelling may affect reproduction in egg size, egg amount, and egg quality. El Niño and La Niña effect of the upwelling due to the drastic changes in the warmth of water.

Conservation[edit]

Recreational and commercial fisheries off the coast of California rely heavily on bocaccio. They are caught by trawling, gillnetting and hook and line. Overfishing has occurred over the past decade. Commercial fishermen tend to target bocaccio due to their abundance and longer shelf life. The California Department of Fish and Game has set a regulation limit of 2 bocaccio per day at a minimum length of 10 inches (250 mm). Also, the depths of fishing have decreased now as older and larger Bocaccio tend to stay deeper because the deepest fishermen can fish at is around 240 feet (73 m).

Studies off of Southern California oil platforms show they have produced a slight increase on bocaccio population. Juveniles like to use these platforms as they provide a resemblance of a natural habitat with more protection,[6][7] and because of the availability of plankton. Studies showed that out of eight platforms there was a large amount of young juvenile bocaccio at seven platforms.

In January 2001 the U.S. National Marine Fisheries Service (NMFS) received a petition to list the southern population of bocaccio as a Threatened species under the U.S. Endangered Species Act (ESA).[8] In November 2002, NMFS published its recommendation that ESA listing was not warranted.

The southern distinct population segment of bocaccio is a U.S. National Marine Fisheries Service Species of Concern.[9] Species of Concern are those species about which the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act[8]

On October 29, 2007, NMFS received a petition from Mr. Wright to list the Puget Sound DPS of bocaccio under the ESA. NMFS concluded that there was enough information in this new petition and in a status review to propose listing this species as endangered.[10] A final listing determination is due in October 2009.

References[edit]

  1. ^ Sobel, J. (1996). "Sebastes paucispinus (sic)". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 31 March 2014. 
  2. ^ a b Love, Milton (1996). Probably more than you Want to know about the Fishes of the Pacific Coast. Santa Barbara: Really Big Press. pp. 179–182. 
  3. ^ Phillips, Julius B. (1964). "Life History Studies on ten species of Rockfish". Marine Resources Operations. pp. 20–23. 
  4. ^ "Boccacio". AFSC Guide to Rockfishes. Alaska Fisheries Science Center, NOAA Fisheries Service. Retrieved June 30, 2014. 
  5. ^ Tolimieri, N. (2005). "The roles of fishing and climate in the population dynamics of bocaccio rockfish". Ecological applications. 15 (2). pp. 458–468. 
  6. ^ Love, MS (2006). "The relationships between fish assemblages and the amount of bottom horizontal beam exposed at California oil platforms: fish habitat preferences at man-made platforms and (by inference) at natural reefs". Fishery Bulletin of the Fish and Wildlife Service. 104 (4): 542–549. 
  7. ^ Love, MS (2006). "Potential use of offshore marine structures in rebuilding an overfished rockfish species, bocaccio (Sebastes paucispinis)". Fishery Bulletin of the Fish and Wildlife Service. 104 (3): 383–390. 
  8. ^ a b "Endangered Species Act (ESA)". Retrieved May 25, 2007. 
  9. ^ "Proactive Conservation Program: Species of Concern". Retrieved May 25, 2007. 
  10. ^ "Bocaccio (Sebastes paucispinis)". Retrieved May 25, 2007. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: NMFS (2002) recognized two discrete population segments, north and south of an area of scarcity in northern California and southern Oregon. These segments have a 90 percent probability of being genetically distinct from each other (NMFS 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!