Overview

Comprehensive Description

Biology

Inhabit rocky reefs, mainly at depths greater than 10 m (Ref. 27436). Solitary and territorial, defending a home crevice among rocks (Ref. 2850). Juveniles pelagic (Ref. 27436). Viviparous (Ref. 34817). Quickly changes color when disturbed or when there is a change in lighting (Ref. 6885). Caught infrequently and incidentally marketed as rockfish (Ref. 27436). Flesh firm and tasty (Ref. 27436).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Cape Resurrection, Kenai Peninsula, Alaska to Point Buchon, central California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 6 - 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 610 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

61.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 2,220 g (Ref. 40637); max. reported age: 116 years (Ref. 39247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head spines strong - nasal, preocular, supraocular, postocular, tympanic, coronal, parietal and nuchal spines present (Ref. 27437). Strongly concave between eyes; parietal ridges very thick and coarse (Ref. 27437). Caudal fin rounded (Ref. 6885). Light pink to red with 5 or 6 black or dark red bars on body; 2 dark bars radiating from each eye (Ref. 27437).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 10 - 275 m (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 275m.
From 10 to 275 meters.

Habitat: reef-associated. Solitary and territorial, defending a home crevice among rocks. Quickly changes color when disturbed or when there is a change in lighting (Ref. 6885).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 116 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes nigrocinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATCCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTACTATTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCTTAGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTTGGGGCAATCAATTTTATTACCACAATTATTAATATAAAGCCCCCGGCCATCTCTCAATACCAGACACCCCTGTTTGTGTGAGCCGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCAGGCGGAGGGGATCCAATCCTTTACCAACACTTATTCTGGTTTTTTGGACACCCGGAAGTATATATTCTCATTCTACCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGTTATATAGGCATGGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCCCACCACATATTTACAGTTGGCATGGACGTAGACACGCGTGCTTATTTCACATCTGCCACAATAATCATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTGGCCAATTCATCTCTAGATATTGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACGTACTATCTATGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes nigrocinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tiger rockfish

The tiger rockfish Sebastes nigrocinctus (also tiger seaperch, banded rockfish, and black-banded rockfish) is a fish found in rocky reefs and boulder fields. It is found in the northeast Pacific Ocean off Kodiak Island, and from Prince William Sound, Alaska, south to Point Buchon, central California. This species of fish is territorial,[1] and somewhat aggressive in certain cases. The fish lurks between crevices in rocks, and coral reefs.[2][3][4][5][6]

Scientists have dated some fish to be up to 166 years old. It is very vulnerable, with a minimum population doubling time of 14 years.

The tiger rockfish reaches a maximum length of 24 in (61 cm). It is orange or light red with several broad, dark bars along the body.[7]

References[edit]

  1. ^ "Tiger rockfish". Retrieved 2009-02-23. [dead link]
  2. ^ "Tiger Rockfish". Retrieved 2009-02-23. 
  3. ^ "Tiger rockfish — IslandWood". Retrieved 2009-02-23. 
  4. ^ "Sebastes nigrocinctus, Tiger rockfish: fisheries, gamefish, aquarium". Retrieved 2009-02-23. 
  5. ^ "Sebastes nigrocinctus-Tiger Rockfish". Retrieved 2009-02-23. 
  6. ^ "Rockfish". Retrieved 2009-02-23. 
  7. ^ "Tiger Rockfish". Retrieved 2009-02-23. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!