Sebastes auriculatus — Details

Rock Cod learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

A sedentary rockfish found in shallow water and bays (Ref. 2850), among sheltering weed-covered rocks or around pilings (Ref. 27436). Viviparous, with planktonic larvae and pelagic juveniles (Ref. 36715). Fin spines are sharp and mildly venomous and can cause annoying wounds (Ref. 27436). Small live specimens make excellent bait for large lingcod (Ref. 27436). Flesh is firm and tasty, but rarely found in markets (Ref. 26346).

Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850) http://www.fishbase.org/references/FBRefSummary.php?id=2850&speccode=2592

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific

Gillespie, G. E. 1993. An updated list of the fishes of British Columbia, and those of interest in adjacent waters, with numeric code designations. Can. Tech. Rep. Fish. Aquat. Sci. 1918: 116 p. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=155121
Hart, J.L., 1973. Pacific Fishes of Canada. Fish. Res. Bd. Can. Bull 180. 740 pages. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=147633

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Eastern Pacific: Prince William Sound, Alaska to central Baja California, Mexico.

Kramer, D.E. and V.M. O'Connell 1995 Guide to Northeast Pacific rockfishes. Genera Sebastes and Sebastolobus. Alaska Sea Grant, Marine Advisory Bulletin No. 25. (Ref. 27437) http://www.fishbase.org/references/FBRefSummary.php?id=27437&speccode=502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

National Distribution

Learn more about this article

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Eastern North Pacific.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 15; Analspines: 3; Analsoft rays: 5 - 8; Vertebrae: 26 - 27

Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885) http://www.fishbase.org/references/FBRefSummary.php?id=6885&speccode=2594

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 560 mm NG

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

56.0 cm TL (male/unsexed; (Ref. 27437)); max. reported age: 34 years (Ref. 56049)

Shanks, A.L. and G.L. Eckert 2005 Population persistence of California Current fishes and benthic crustaceans: a marine drift paradox. Ecol. Monogr. 75:505-524. (Ref. 56049) http://www.fishbase.org/references/FBRefSummary.php?id=56049&speccode=4150
Kramer, D.E. and V.M. O'Connell 1995 Guide to Northeast Pacific rockfishes. Genera Sebastes and Sebastolobus. Alaska Sea Grant, Marine Advisory Bulletin No. 25. (Ref. 27437) http://www.fishbase.org/references/FBRefSummary.php?id=27437&speccode=502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Head spines strong - nasal, preocular, postocular, tympanic, coronal (may be absent), parietal, and nuchal (may be absent) spines present, supraoculars absent (Ref. 27437). Interorbital space flat to barely convex; symphyseal knob weak or absent (Ref. 27437). Caudal fin rounded (Ref. 6885). Light brown, mottled with one or two shades of darker brown, vague dark bars dorsally, dark brown blotch on upper part of gill cover; fins and underside of throat and lower jaw pinkish (Ref. 27437). Branchiostegal rays: 7 (Ref. 36715).

Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885) http://www.fishbase.org/references/FBRefSummary.php?id=6885&speccode=2594

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Syntype for Sebastes auriculatus Girard
Catalog Number: USNM 348
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): Williamson
Locality: San Diego, San Diego County, California, United States, North America, Pacific

Syntype: Girard, C. F. 1854. Proceedings of the Academy of Natural Sciences of Philadelphia. 7: 131.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

demersal; marine; depth range 0 - 128 m (Ref. 27437)

Kramer, D.E. and V.M. O'Connell 1995 Guide to Northeast Pacific rockfishes. Genera Sebastes and Sebastolobus. Alaska Sea Grant, Marine Advisory Bulletin No. 25. (Ref. 27437) http://www.fishbase.org/references/FBRefSummary.php?id=27437&speccode=502

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 9 - 213
  Temperature range (°C): 6.630 - 7.150
  Nitrate (umol/L): 22.850 - 30.351
  Salinity (PPS): 33.220 - 33.811
  Oxygen (ml/l): 2.565 - 4.255
  Phosphate (umol/l): 1.934 - 2.545
  Silicate (umol/l): 35.115 - 46.900

Graphical representation

Depth range (m): 9 - 213

Temperature range (°C): 6.630 - 7.150

Nitrate (umol/L): 22.850 - 30.351

Salinity (PPS): 33.220 - 33.811

Oxygen (ml/l): 2.565 - 4.255

Phosphate (umol/l): 1.934 - 2.545

Silicate (umol/l): 35.115 - 46.900

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Habitat Type: Marine

Comments: Shallow coastal waters and bays, near shore and to 128 m (Eschmeyer and Herald 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 0 - 128m.
Recorded at 128 meters.

Habitat: demersal. Widespread in shallow water and bays.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Viviparous (Ref. 36715, 34817).

Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715) http://www.fishbase.org/references/FBRefSummary.php?id=36715&speccode=8222

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life Expectancy

Lifespan, longevity, and ageing

Learn more about this article

Maximum longevity: 20 years (wild)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes auriculatus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 36 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATGAATAACATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTTCTACTCGCCTCTTCTGGGGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAGTACCAGACACCCCTATTTGTATGAGCTGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACTACCTTCTTTGACCCCGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTCTTTGGACACCCGGAAGTATATATTCTCATTTTGCCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTATTCTGGCAAAAAAGAACCCTTTGGCTACATAGGCATAGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCTCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCCTATTTTACATCTGCCACAATAATTATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTATACAGTAGGGGGGATTACAGGCATTGTTCTGGCCAATTCATCTATAGATATTGTACTCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Sebastes auriculatus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 36
Specimens with Barcodes: 37
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History and Museum of Tropical Queensland

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

National NatureServe Conservation Status

Learn more about this article

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

NatureServe Conservation Status

Learn more about this article

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; bait: occasionally; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus

Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183) http://www.fishbase.org/references/FBRefSummary.php?id=9183&speccode=2594
Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436) http://www.fishbase.org/references/FBRefSummary.php?id=27436&speccode=2594
Canadian Department of Fisheries and Oceans 1995 British Columbia tidal waters sport fishing guide 1995-1996. Canadian Dept. of Fisheries and Oceans. (Ref. 11007) http://www.fishbase.org/references/FBRefSummary.php?id=11007&speccode=1520

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!