Overview

Comprehensive Description

Biology

A sedentary rockfish found in shallow water and bays (Ref. 2850), among sheltering weed-covered rocks or around pilings (Ref. 27436). Viviparous, with planktonic larvae and pelagic juveniles (Ref. 36715). Fin spines are sharp and mildly venomous and can cause annoying wounds (Ref. 27436). Small live specimens make excellent bait for large lingcod (Ref. 27436). Flesh is firm and tasty, but rarely found in markets (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Prince William Sound, Alaska to central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 15; Analspines: 3; Analsoft rays: 5 - 8; Vertebrae: 26 - 27
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 560 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

56.0 cm TL (male/unsexed; (Ref. 27437)); max. reported age: 34 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head spines strong - nasal, preocular, postocular, tympanic, coronal (may be absent), parietal, and nuchal (may be absent) spines present, supraoculars absent (Ref. 27437). Interorbital space flat to barely convex; symphyseal knob weak or absent (Ref. 27437). Caudal fin rounded (Ref. 6885). Light brown, mottled with one or two shades of darker brown, vague dark bars dorsally, dark brown blotch on upper part of gill cover; fins and underside of throat and lower jaw pinkish (Ref. 27437). Branchiostegal rays: 7 (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Sebastes auriculatus Girard
Catalog Number: USNM 348
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): Williamson
Locality: San Diego, San Diego County, California, United States, North America, Pacific
  • Syntype: Girard, C. F. 1854. Proceedings of the Academy of Natural Sciences of Philadelphia. 7: 131.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Shallow coastal waters and bays, near shore and to 128 m (Eschmeyer and Herald 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 128 m (Ref. 27437)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 9 - 213
  Temperature range (°C): 6.630 - 7.150
  Nitrate (umol/L): 22.850 - 30.351
  Salinity (PPS): 33.220 - 33.811
  Oxygen (ml/l): 2.565 - 4.255
  Phosphate (umol/l): 1.934 - 2.545
  Silicate (umol/l): 35.115 - 46.900

Graphical representation

Depth range (m): 9 - 213

Temperature range (°C): 6.630 - 7.150

Nitrate (umol/L): 22.850 - 30.351

Salinity (PPS): 33.220 - 33.811

Oxygen (ml/l): 2.565 - 4.255

Phosphate (umol/l): 1.934 - 2.545

Silicate (umol/l): 35.115 - 46.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 128m.
Recorded at 128 meters.

Habitat: demersal. Widespread in shallow water and bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous (Ref. 36715, 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sebastes auriculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 36
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sebastes auriculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATGAATAACATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTTCTACTCGCCTCTTCTGGGGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAGTACCAGACACCCCTATTTGTATGAGCTGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACTACCTTCTTTGACCCCGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTCTTTGGACACCCGGAAGTATATATTCTCATTTTGCCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTATTCTGGCAAAAAAGAACCCTTTGGCTACATAGGCATAGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCTCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCCTATTTTACATCTGCCACAATAATTATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTATACAGTAGGGGGGATTACAGGCATTGTTCTGGCCAATTCATCTATAGATATTGTACTCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History and Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; bait: occasionally; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown rockfish

The brown rockfish (Sebastes auriculatus),[2] whose other names include brown seaperch, chocolate bass, brown bass, and brown bomber, is a species of ray-finned fish in the family Sebastidae.

Description[edit]

The brown rockfish has a body colored in various shades of brown. In this species, the background color is overlaid with dark-brown, red-brown, or blackish mottling. The rear area of the gill cover has a prominent dark patch which probably inspired its Latin name auriculatus, meaning "eared". This blotch may become faint in larger specimens. Stripes of red-brown, brown, or orange radiate back from the upper jaw and eyes. Brown rockfish in Puget Sound and off central California commonly have coronal spines, while in southern California waters, these spine are generally absent. The brown rockfish often resembles the copper rockfish, but the latter lack the dark patch on their gill cover and have lighter areas along their lateral line. The brown rockfish may also be confused with the vermillion rockfish in deep water, and the grass rockfish in shallow water. Along the Pacific coast of the United States, more than one population of these fish may exist. The brown rockfish can grow to about 56 cm (22.0 in) in length, with the females being potentially larger than the males. Both sexes have similar growth rates and life spans, and are known to live to at least 34 years of age.

Distribution and habitat[edit]

The brown rockfish is native to the northeastern Pacific. Its range extends from Bahia San Hipolito in southern Baja California to Prince William Sound in the northern Gulf of Alaska. These fish are most abundant in the central and southern parts of Puget Sound and from southern Baja California to Bodega Bay in northern California.

Biology[edit]

Juveniles and subadults are thought to have relatively small home ranges. They commonly live at shallow inshore depths of 396 ft. (120 m), and can occasionally be found as deep as 444 ft. (135 m). The adults and subadults are commonly found near the sea bottom over both high and low terrain, and sometimes among eelgrass or other vegetation. Pelagic juveniles are at shallower depths of about 120 ft. (36 m). They live alone or in small groups and are found in waters more turbid than many other rockfishes. In shallower waters off southern California, brown rockfish are abundant around some oil platforms. The juveniles are prey to harbor seals and king salmon. The brown rockfish feeds primarily at night on small fishes, crab, shrimp, and other small invertebrates. During the day this fish tends to lie on the seabed among seaweed or next to rocks or in other hidden locations. Its spines are venomous and can cause painful injuries to the unwary.[3]

References[edit]

  1. ^ "WoRMS taxon details - Sebastes auriculatus (Girard, 1854)". World Register of Marine Species. Retrieved 23 November 2013. 
  2. ^ "Sebastes auriculatus (Girard, 1854) - Brown rockfish". FishBase. Retrieved 23 November 2013. 
  3. ^ "Brown rockfish". Oceanário de Lisboa. Retrieved 2013-12-19. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!