Overview

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Apogonichthyoides enigmaticus
Catalog Number: USNM 337777
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Mee
Year Collected: 1990
Locality: Near the Kuria Muria Islands, Arabian Sea, Oman., Oman, Arabian Sea, Indian
Depth (m): 45 to 50
Vessel: Rastrelliger
  • Paratype: Mee, J. 1996. Journal of South Asian Natural History. 2 (1): 104, 1, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Apogonichthyoides enigmaticus
Catalog Number: USNM 337776
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Mee
Year Collected: 1989
Locality: Sudah Harbor, Arabian Sea, Oman., Oman, Arabian Sea, Indian
Depth (m): 2 to 2
  • Paratype: Mee, J. 1996. Journal of South Asian Natural History. 2 (1): 104, 1, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.55 - 70.15
  Temperature range (°C): 25.637 - 25.689
  Nitrate (umol/L): 0.085 - 2.503
  Salinity (PPS): 35.274 - 35.280
  Oxygen (ml/l): 4.163 - 4.812
  Phosphate (umol/l): 0.175 - 0.312
  Silicate (umol/l): 0.768 - 0.819

Graphical representation

Depth range (m): 0.55 - 70.15

Temperature range (°C): 25.637 - 25.689

Nitrate (umol/L): 0.085 - 2.503

Salinity (PPS): 35.274 - 35.280

Oxygen (ml/l): 4.163 - 4.812

Phosphate (umol/l): 0.175 - 0.312

Silicate (umol/l): 0.768 - 0.819
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apogon apogonides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apogon apogonoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Apogon apogonoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATAGTCGGGACTGCACTT---AGCCTGCTTATTCGAGCCGAACTAAGTCAACCTGGGGCCCTCCTCGGCGAT---GACCAAATTTATAATGTAATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTTGGAAACTGACTAATCCCCCTAATG---ATTGGTGCCCCCGACATAGCATTCCCTCGGATAAATAATATGAGCTTCTGGCTTCTCCCTCCCTCTTTCCTTCTTCTCCTTGCCTCCTCTGGTGTAGAAGCCGGAGCTGGGACAGGATGAACTGTGTACCCTCCTCTTGCAGGCAATCTCGCCCATGCAGGAGCTTCCGTTGATTTA---ACAATTTTTTCTCTGCACCTGGCTGGTGTGTCGTCAATTCTTGGGGCCATCAACTTTATTACTACAATTATTAATATGAAACCCCCTGCTATTACTCAGTACCAAACTCCTCTATTCGTCTGAGCAGTCCTTATTACTGCAGTCCTCCTACTTCTTTCCCTGCCTGTTCTAGCGGCT---GGCATTACTATACTCCTTACAGACCGGAATCTAAATACAACCTTCTTTGACCCAGCAGGGGGTGGGGACCCGATCCTTTATCAACATCTGTTCTGATTCTTCGGGCACCCAGAAGTATACATTCTTATTTTACCAGGGTTCGGCATGATTTCTCATATTGTTGCCTACTACGCCGGTAAAAAA---GAACCTTTCGGCTATATGGGCATGGTCTGAGCTATGATGGCAATCGGCCTGCTAGGATTTATTGTATGAGCCCACCACATGTTTACAGTTGGAATGGACGTCGACACTCGAGCATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Apogon apogonides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCTTGGGCCGGAATAGTCGGGACTGCGCTTAGCCTACTCATTCGAGCTGAACTAAGTCAACCTGGGGCCCTCCTCGGCGATGACCAAATCTATAATGTAATCGTTACAGCACATGCATTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCACTAATGATTGGTGCCCCCGACATAGCATTCCCCCGAATAAATAATATGAGCTTCTGGCTTCTCCCTCCCTCTTTCCTCCTTCTACTTGCCTCCTCTGGTGTAGAAGCTGGGGCTGGGACAGGATGAACTGTTTACCCCCCTCTTGCGGGCAATCTCGCCCATGCGGGAGCTTCCGTTGATTTAACAATTTTTTCGCTACACCTGGCTGGTGTGTCATCAATTCTTGGAGCCATCAACTTTATTACTACAATTATTAACATGAAACCCCCTGCTATCACTCAGTACCAAACTCCTCTGTTCGTTTGAGCAGTCCTTATTACTGCAGTCCTTCTCCTTCTTTCCTTGCCCGTCCTAGCAGCTGGCATCACTATGCTCCTTACAGATCGAAATTTAAATACAACCTTCTTTGATCCAGCAGGGGGTGGTGACCCAATCCTTTATCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!