Overview

Distribution

South America: Coastal river drainages from Espírito Santo to Rio Grande do Sul, Brazil and upper Paraná River basin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal river drainages from Espírito Santo to Rio Grande do Sul States and upper Paraná River basin: Argentina and Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 40 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

4.7 cm TL (male/unsexed; (Ref. 38376))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; pH range: 5.8 - 8.0; dH range: 30
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hyphessobrycon bifasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACAAAGACATTGGCACCCTCTATCTAGTATTTGGTGCCTGAGCTGGGATGGTCGGAACTGCTCTAAGCCTATTAATTCGGGCAGAGCTGGGCCAACCGGGATCCCTTCTAGGCGATGATCAGGTATATAATGTTCTGGTAACCGCACATGCTTTTGTTATAATTTTCTTTATAGTTATACCTGTAATGATTGGGGGCTTTGGAAATTGACTTGTCCCACTTATAATTGGTGCCCCAGACATAGCCTTTCCTCGAATAAATAACATAAGTTTCTGACTCCTCCCCCCATCTTTCCTTCTCCTCCTAGCATCATCAGGTGTAGAAGCTGGGGCAGGGACAGGCTGAACTGTATACCCCCCTCTTGCTGGTAATCTAGCACACGCAGGGGCCTCTGTAGACCTAACAATTTTTTCACTTCACCTGGCTGGTGTATCCTCTATTTTAGGGGCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCAGCTATTTCACAATACCAAACACCTCTATTTGTCTGGGCTGTCCTAATCACAGCTGTACTCCTCCTCCTTTCGCTCCCTGTTCTAGCAGCTGGTATTACGATACTTCTCACAGACCGTAACCTTAACACTTCATTTTTTGACCCTGCAGGAGGTGGAGACCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hyphessobrycon bifasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!