Overview

Distribution

South America: Coastal river drainages from Espírito Santo to Rio Grande do Sul, Brazil and upper Paraná River basin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal river drainages from Espírito Santo to Rio Grande do Sul States and upper Paraná River basin: Argentina and Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 40 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

4.7 cm TL (male/unsexed; (Ref. 38376))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; pH range: 5.8 - 8.0; dH range: 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hyphessobrycon bifasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACAAAGACATTGGCACCCTCTATCTAGTATTTGGTGCCTGAGCTGGGATGGTCGGAACTGCTCTAAGCCTATTAATTCGGGCAGAGCTGGGCCAACCGGGATCCCTTCTAGGCGATGATCAGGTATATAATGTTCTGGTAACCGCACATGCTTTTGTTATAATTTTCTTTATAGTTATACCTGTAATGATTGGGGGCTTTGGAAATTGACTTGTCCCACTTATAATTGGTGCCCCAGACATAGCCTTTCCTCGAATAAATAACATAAGTTTCTGACTCCTCCCCCCATCTTTCCTTCTCCTCCTAGCATCATCAGGTGTAGAAGCTGGGGCAGGGACAGGCTGAACTGTATACCCCCCTCTTGCTGGTAATCTAGCACACGCAGGGGCCTCTGTAGACCTAACAATTTTTTCACTTCACCTGGCTGGTGTATCCTCTATTTTAGGGGCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCAGCTATTTCACAATACCAAACACCTCTATTTGTCTGGGCTGTCCTAATCACAGCTGTACTCCTCCTCCTTTCGCTCCCTGTTCTAGCAGCTGGTATTACGATACTTCTCACAGACCGTAACCTTAACACTTCATTTTTTGACCCTGCAGGAGGTGGAGACCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hyphessobrycon bifasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!