Overview

Comprehensive Description

Biology

Inhabits shallow coral reefs over coral, sand, rubble or seagrass substrata (Ref. 46844). Forms tight coherent schools when chased (Ref. 80499). Feeds on zooplankton and forms evasive, compact schools when threatened (Ref. 46844).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is only found in the Pelican Keys, Belize and has an estimated extent of occurrence of less than 10 km2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Off Belize, inside the barrier reef.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Atlantic: known only from Belize. Expected to be found elsewhere along the continental shores of the Caribbean Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 11 - 12; Vertebrae: 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

4.7 cm SL (male/unsexed; (Ref. 80499))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head and back gray-green with a narrow midlateral black-brown stripe from front of snout to caudal fin base, ending in a prominent black spot; second narrow brown stripe on lower side, the pale gray zone on the lower side between the two black-brown stripes bisected by a narrow white stripe; a narrow brown stripe on body at each side of base of dorsal fin, continuing middorsally on nape as a double stripe; occiput dark brown; the black caudal base spot rimmed with blue and white except posteriorly (Ref. 46844).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Halichoeres socialis
Catalog Number: USNM 352855
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Lobel & Class
Year Collected: 1997
Locality: Belize, Pelican Cays, Tunicate Cove, Pelican Cays, Belize, Caribbean Sea, Atlantic
Depth (m): 1 to 5
  • Paratype: Randall, J. E. & Lobel, P. S. 2003. Copeia. 2003 (1): 125, 1-3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Halichoeres socialis
Catalog Number: USNM 352854
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Lobel & Class
Year Collected: 1997
Locality: Belize, Pelican Cays, Tunicate Cove, Pelican Cays, Belize, Caribbean Sea, Atlantic
Depth (m): 1 to 5
  • Holotype: Randall, J. E. & Lobel, P. S. 2003. Copeia. 2003 (1): 125, 1-3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adults are reef associated, and juveniles are mangrove and shallow reef dependent. It is found in shallow coral reefs over coral, sand, rubble or seagrass substrata (Randall and Lobel 2003) to depths of 10 m. Juveniles feed on zooplankton and form evasive, compact schools when threatened (Randall and Lobel 2003). Estimated larval life of two to three weeks, however, it may not be able to disperse outside known area given the possible lack of suitable habitat.

Life history traits (longevity and age of maturity) are based on similar species in this genus of similar size.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 7 m (Ref. 46844)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 3 - 3
  Temperature range (°C): 28.365 - 28.365
  Nitrate (umol/L): 0.469 - 0.469
  Salinity (PPS): 32.409 - 32.409
  Oxygen (ml/l): 4.614 - 4.614
  Phosphate (umol/l): 0.176 - 0.176
  Silicate (umol/l): 4.761 - 4.761
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow coral reefs over coral, sand, rubble or seagrass substrata (Ref. 46844). Feeds on zooplankton and forms evasive, compact schools when threatened (Ref. 46844).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres socialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTCGGCGCCTGAGCTGGGATAGTGGGTACGGCCTTGAGCCTACTTATTCGGGCTGAATTAAGCCAACCCGGCGCTCTCCTTGGGGAC---GACCAGATCTATAACGTAATCGTTACAGCCCACGCATTCGTAATAATTTTCTTTATAGTGATACCCATTATGATTGGCGGATTTGGAAATTGACTAATCCCCCTCATGATTGGTGCCCCTGACATGGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTTCTCCCGCCTTCCTTCCTCCTCCTGCTTGCCTCTTCTGGTGTAGAGGCTGGAGCCGGTACCGGATGAACAGTTTACCCGCCTTTAGCAGGAAATCTTGCGCACGCCGGTGCATCTGTAGACCTCACAATCTTTTCTCTCCACCTGGCCGGTATTTCGTCAATTCTGGGGGCTATCAACTTCATTACTACTATTATTAATATGAAGCCTCCTGCTATTTCCCAATATCAAACGCCCCTCTTCGTTTGAGCCGTCCTAATTACAGCCGTACTTCTCCTCCTTTCCCTCCCAGTCCTTGCCGCTGGCATTACAATGCTTCTTACAGATCGAAATTTAAATACTACTTTCTTTGACCCGGCTGGAGGGGGCGATCCAATTTTATACCAACACTTATTCTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres socialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L., Choat, H. & Craig, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is restricted to a single location (Pelican Caye World Heritage Site, Belize) and has an estimated extent of occurance of less than 10 km2. This shallow water species is dependent on a unique combination of coral and mangrove habitat, especially for juveniles. Significant habitat loss is occuring due to mangrove and coral removal for extensive coastal development within its very restricted range. It is listed as Critically Endangered. More research is urgently needed on this species' population status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Currently, population size and trends have not been assessed. From the original description, it may seem that the population numbers are high, as juveniles are abundant where they occur. However, adult individuals are rarely observed.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is threatened by extensive habitat destruction within and around this species' very restricted range within the Pelican Caye World Heritage Site. Habitat loss is due to continued extensive mangrove and coral removal and dredging for coastal and resort development at least since 2003.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critically Endangered (CR) (B1ab(iii))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Pelican Caye is a World Heritage Site but there is no actual protection. Given this species very small range and extensive habitat loss, it should be carefully monitored and effective conservation measures and outreach are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!