Overview

Comprehensive Description

Biology

Inhabits shallow, mud-bottomed ditches, bays, salt marshes and other brackish-water environments; also crab burrows (Ref. 5723). Can withstand heavy pollution of fresh or salty waters and shares its biotope with Poecilia vivipara which is much more abundant (Ref. 35237). Usually found in water with low oxygen content (Ref. 7251). Either male or hermaphroditic, females don't seem to exist. Only about 5% of a population are born as males; after 3-4 years about 60% of the (self-fertilizing) hermaphrodites transform into secondary males by losing female structure and function. The proportion of males depends on the environmental temperature. Below 20°C, majority are males, above 25°C all are hermaphrodites (Ref. 35237). It is the only known naturally occurring, self-fertilizing vertebrate (Ref. 13056, 35237). Not a seasonal killifish. Is very difficult to maintain in aquarium (Ref. 27139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species is widely distributed throughout the West Indies region, from the Bahamas, including Bimini and the Andro Island (Harrington and Rivas 1958), south to northern and eastern South America to Venezuela (Taphorn 1980), including both the Greater Antilles and Lesser Antilles (Seegers 1984, Huehner et al. 1985). It also occurs along the southern half of peninsular Florida and in portions of the Florida Keys (Fowler 1928, Gilbert and Burgess 1980, Huehner et al. 1985, Taylor and Snelson 1992).

This fish was first reported in the United States from Key West (Fowler 1928, Hastings 1969). It has since been collected from several locations on both coasts of Florida on the east coast as far north as the Indian River Lagoon (Harrington and Rivas 1958, Taylor 1988. Davis et al. 1995) and near Ft. Myers (Tampa Bay) and on the west coast in mangrove and mosquito ditch habitats (Hastings 1969, Brockmann 1975, Robins et al. 1986, Taylor and Snelson 1992, Turner et al. 1992, Harrington and Rivas 1958). It is known from all east coast counties in Florida north to Brevard County, with the exception of Palm Beach County (Taylor 1993). The distribution closely parallels that of the red mangrove (Cardosoma guanhumi) with which this fish is closely associated (Davis et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North, Central and South America: eastern coasts of Florida (Indian River to Key West) in USA and Bahamas to Cuba, Jamaica, Cayman Island, Brazil, French Guiana, the Netherlands Antilles, Venezuela, Belize, Mexico, Puerto Rico. Throughout Caribbean (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic drainages of North, Central and South America; introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 4 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 60 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 27139))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from topminnows and killifishes in having tubular anterior nares (Page and Burr 1991, Taylor and Snelson 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dark spot surrounded by yellow ring on side of caudal peduncle, just ahead of upper part of caudal fin base (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Rivulus marmoratus
Catalog Number: USNM 123000
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Poey
Locality: Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Cotype: Rivas, L. R. 1945. Journal of the Washington Academy of Sciences. 35 (3): 45.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype for Rivulus marmoratus
Catalog Number: USNM 37429
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): F. Poey
Locality: Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Lectotype: Rivas, L. R. 1945. Journal of the Washington Academy of Sciences. 35 (3): 45.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Primarily coastal brackish and saltwater areas usually with low oxygen content and hard-bottom areas with silt cover (Voss et al. 1969, Loftus and Kushlan 1987, Davis et al. 1995); usually collected from mangrove or high salt marsh habitats in a salinity of 20-35 parts per thousand (Davis et al. 1990, Taylor and Snelson 1992, Taylor 1993). Also reported from freshwater where it is considered rare (Tabb and Manning 1961, Loftus and Kushlan 1987). In very shallow, stagnant water over marly muck, often associated with detritus and scant vegetation. On the east coast of Florida, often found living in burrows of the land crab Cardiosoma guanhumi, especially in beds of saltwort and glasswort; also inhabits the burrows of other crabs such as Ucides cordatus in Belize (Taylor 1989b, Davis et al 1990). See Taylor and Snelson (1992).

Individuals are capable of leaving the water by burrowing through leaf litter (Huehner et al. 1985) and also have been observed out of the water attached to the underside of mangrove leaves. An extensive network of capillaries in the skin and fins allow absorption of oxygen when out of the water (Taylor 1989). This behavior is likely a generalized response to environmental stress, including high concentrations of hydrogen sulfide, as well as a means of exploiting terrestrial resources (Abel et al. 1987). Eggs are able to survive for considerable periods of time out of the water in the mangrove forest substrate (Ritchie and Davis 1986). Adults are also capable of burrowing into moist mud when crab burrows dry up. They can stay buried in the mud for at least 60 days until the burrows become flooded once again by higher tides (Taylor 1989b).

Rivulus marmoratus is promising as a good estuarine bio-indicator species (to determine responses to toxins), due to its naturally inbred genetic attributes, fast growth rate, and simple husbandry (Lin and Dunson 1993, Park et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; brackish; pH range: 7.5; dH range: 16; depth range 0 - ? m (Ref. 55170)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Limited food studies indicate a diet of small crabs, snails, insects, worms, small fishes, and vegetable matter (Taylor and Snelson 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations) and locations (as defined by IUCN). Much of the range has not been surveyed. Field accounts are rare due to the small size and difficulty of sampling in the mangrove habitat (Taylor 1988). However, it is thought to occur at many sites throughout the rather large range (Taylor and Snelson 1992).

In 1958, there were 37 populations considered extant in the United States, all in Florida (Harrington and Rivas 1958).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 10,000. There are no data to indicate exactly how many individuals currently exist or have been eliminated (Taylor 1989b).

The species apparently is widely distributed and locally rare and is more common in Florida than had been previously thought. The species is apparently abundant throughout the Florida Keys, although it has been overlooked in the past due to inadequate ichthyological collecting methods (Davis et al. 1990). As many as 26 individuals have been collected from a single burrow of the great land crab (CARDOSOMA GUANHUMI) along the Indian River Lagoon (Taylor 1989a,1990). However, most collections (based on 111 specimens collected) typically consisted of one or two individuals per burrow (Taylor 1992). Collections of greater than 140 specimens have been taken at night by several collectors at a mangrove site in Collier County, Florida (Taylor 1988). Additional specimens have been found in this habitat in south Florida and the Florida Keys (Davis et al. 1990). Fifty-one individuals were found under partially submerged logs and less frequently in leaf litter in intertidal areas of Big Mangrove Key (east of Big Pine Key), Florida; two individuals were found in identical habitats on Grand Cayman, British West Indies (Huehner et al. 1985).

Fifteen individuals were collected from a population in the Maracaibo River Basin in Venezuela (Taphorn 1980).

Populations usually consist of all female individuals. However, collections on several cays off the coast of Belize yielded 13.5-24 percent males of the 305 specimens sampled (Turner at al 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Included in the diet of the wood stork in Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are sometimes fertilized internally by accident via close apposition of gonopores in otherwise oviparous fishes (Ref. 7471). Regarded as a self-fertilizing hermaphrodite (Ref. 6028, 245, 35237). Eggs are 1.6 mm in diameter. Sexes can be distinguished after 8 weeks (Ref. 35237).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In the northern part of the range, including Florida, this species functions exclusively as a synchronous self-fertilizing hermaphrodite, with internal fertilization, the only such example known among vertebrates (Harrington 1961, Taylor and Snelson 1992). This results in a high degree of homozygosity within apparently healthy populations.

Males can be induced in the laboratory by subjecting eggs to low temperatures (Taylor et al. 1995), and hermaphrodites changed into secondary males in response to shorter day-length (Harrington 1971). Male fish are very rare in Florida but have been reported to be more common in the West Indies (Kristensen 1970) and Central America (Davis et al. 1990). Apparently pure female individuals (that are 100 days old or younger) also exist and there is an age-dependent shift in sex allocation from a female-dominated population to one dominated by hermaphrodites (Cole and Noakes 1997). At Twin Cays, Belize, males are relatively abundant, and there is evidence of outcrossing (Weibel et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Kryptolebias marmoratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCCATTACACGCTGACTCTTTTCAACTAATCATAAAGACATTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGGACTGCCTTAAGCTTGCTTATTCGAGCAGAACTCAGCCAACCAGGGTCGCTCCTGGGGGACGACCAAATTTATAATGTTATTGTAACAGCGCACGCTTTTGTAATAATCTTTTTTATAGTTATACCCATCATAATCGGGGGCTTTGGTAACTGACTCGTACCTCTAATAATTGGGGCCCCTGACATAGCCTTCCCCCGTATAAACAACATAAGTTTTTGACTTCTCCCTCCCTCTTTCCTTCTTCTTTTAGCATCTTCCGGGGTGGAAGCAGGCGCTGGGACAGGCTGAACAGTCTATCCCCCCCTCGCAGGAAACCTTGCCCACGCCGGGGCTTCTGTTGATCTTACTATTTTCTCGCTACACCTGGCGGGTGTGTCGTCTATTTTAGGCGCCATCAATTTTATTACAACCGGCTTAAATATAAAACCTCCCGCGCTTTCACAGTATCAAACCCCTCTTTTTGTGTGAGCTGTCATAATTACAGCCGTTTTATTACTGCTCTCCTTGCCCGTCCTTGCTGCCGGGATTACGATACTCTTAACTGACCGTAACTTAAACACTACCTTTTTTGACCCGGCCGGGGGAGGAGACCCAATTCTTTATCAGCACCTATTCTGGTTTTTTGGACACCCAGAAGTCTATATTTTAATTCTCCCGGGCTTCGGAATAATTTCCCACATTGTAGCCTACTACTCTGGTAAAAAAGAGCCCTTTGGGTATATGGGAATGGTGTGGGCTATAATAGCCATCGGGCTATTAGGCTTTATTGTGTGGGCTCATCACATGTTTACTGTAGGAATGGACGTAGACACTCGCGCCTACTTTACCTCCGCCACAATAATTATTGCTATTCCTACAGGCGTTAAAGTTTTTAGCTGACTAGCAACCCTTCATGGGGGCGCAATTAAATGAGAGACCCCCCTCCTCTGAGCTTTAGGCTTTATTTTTCTATTTACTGTAGGAGGCTTAACTGGCATCGTGCTCGCCAACTCTTCTTTAGATATTGTACTACATGACACATATTACGTCGTGGCACACTTCCATTATGTTCTCTCTATGGGCGCTGTGTTCGCGATTATCGCCGCATTTGTTCATTGATTTCCCCTGTTTTCAGGCTACACACTTCACGATACCTGAACAAAAATCCATTTTGGGGCTATATTCCTCGGAGTGAATCTTACCTTTTTCCCCCAACACTTCCTTGGGCTCGCTGGAATACCTCGACGGTACTCAGACTATCCTGACGCCTATGCTCTTTGAAACACAATCTCTTCTATTGGGTCTTTAATTTCTTTAGTCGCTGTAATTATATTCTTATTTATTGTCTGAGAGGCTTTCGCAGCCAAACGGGAAGTTCTCTCAGTAGAGCTCACCGCTACAAACGCTGAGTGGCTTCACGGCTGCCCTCCCCCTTATCACACTTTCGAAGAGCCTGCCTTTATTCAATTTAACACCTCAGACCTTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Kryptolebias marmoratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Gimenez Dixon, M.

Reviewer/s

Contributor/s

History
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Wide-ranging in Caribbean region; many occurrences, and probably many unrecorded populations; large population size; more common in Florida than formerly believed; vulnerable to habitat degradation.

Other Considerations: Formerly listed as a threatened species in the Gulf of Mexico, because of a relatively low rate of collection over few localities (Loftus and Kuslan 1987, Randall and Poss 1998). Additional collections have indicated that numerous, temporary populations exist, resulting in a change in its status in Florida to be changed from threatened to a species of special concern (Taylor and Snelson 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: May be declining due to habitat destruction or degradation. Probably has been eliminated from areas along the lower east coast of Florida.

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Habitat destruction is a significant threat. Development of coastal habitats leads to loss of mangroves and general degradation of the estuarine environment; offshore pollution events may also degrade habitat, though this species can withstand considerable water pollution. Habitat remains vulnerable to human activities, especially the impounding of high marsh habitats for mosquito control (Taylor and Snelson 1992, Davis et al 1995, Taylor et al. 1995).

The species appears to already have disappeared from impounded marsh areas in the Indian River Lagoon area in central Florida (Taylor et al. 1995). The mangrove habitat in the central Florida location has been degraded through drastic alteration of vegetation, including loss of many black mangrove trees after construction of impoundments used for mosquito control (Provost 1977). The species' existence in salt marshes is so restricted and unusual that it is constantly in peril (Taylor 1989b). At least in the northern part of the range (Indian River Lagoon, Florida), the species depends on the presence of crab burrows, and crab populations have been declining (Taylor and Snelson 1992) and are only present in non-impounded marshes (Davis et al. 1995). Areas with more habitat disturbance may exhibit greater heterozygosity. For example, there were more heterozygous individuals in a site subjected to human modifications than in a site with less disturbance (Lubinski 1993).

A population in Venezuela exhibited reduction and loss of the pelvic fins. This have resulted from extreme inbreeding (Taphorn 1980). The conservation significance of these conditions is uncertain.

Although this fish is used extensively in bioassays and cancer research, the demand for specimens has been minimal due to the ability to easily maintain this species in the laboratory where it spawns readily (Taylor 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lower Risk: least concern (LR/lc)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected in Biscayne National Park and National Wildlife Refuges of the Florida Keys, USA; may also be present in Everglades National Park.

Needs: Known occurrences of both Kryptolebias marmoratus and the land crab, Cardiosoma guanhumi, should be protected. Currently there are no regulations managing the land crab; the establishment of such regulations should be encouraged (Taylor et al. 1995). Continued and stringent protection of existing intact marsh and mangrove habitats is required (Taylor 1989b). This species is a good indicator of overall health of mangrove systems due to its close association with the mangrove habitat and its high sensitivity to habitat destruction including chemical toxins (Taylor et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: There is a need for continued studies on life history and population dynamics (Taylor and Snelson 1992), including rates of genetic exchange among populations given hermaphroditic reproduction. Minimum viable population size needs to be determined.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Has been used in carcinogenesis testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

aquarium: commercial; bait:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mangrove rivulus

The mangrove killifish or mangrove rivulus, Kryptolebias marmoratus (formerly Rivulus marmoratus),[1] is a species of fish in the Aplocheilidae family. It lives along the east coast of North, Central and South America, from Florida to Brazil. It is about 75 mm long.

The mangrove rivulus is a U.S. National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act (ESA).

Ecology[edit]

Scientists have recently discovered that Mangrove rivulus can spend up to sixty-six consecutive days out of water, which it typically spends inside fallen logs, breathing air through its skin.[2] It enters burrows created by insects inside trees where it relaxes its territorial, aggressive behavior. During this time it alters its gills so that it can retain water and nutrients, while nitrogen waste is excreted through the skin. The change is reversed once they re-enter the water.[3][4]

When jumping on land, the mangrove rivulus does a "tail flip", flipping its head over its body towards the tail end. The rivulus' jumping technique gives it an ability to direct its jumps on land and to make relatively forceful jumps. A team of scientists associated with the Society for Experimental Biology released a video in 2013 showing the jumping technique.[5]

The species consists mostly of hermaphrodites which are known to reproduce by self-fertilization, but males do exist,[6] and there is strong genetic evidence for occasional outcrossing.[7] They are also the only simultaneous hermaphroditic vertebrates, and the concentration of males to hermaphrodites can vary depending on the local requirement for genetic diversity (for example, if there was an increase in the local parasite population, secondary male numbers would increase).[8]

Conservation[edit]

This species is extremely vulnerable to habitat modification and fragmentation, environmental alteration, and human development/encroachment.

Conservation designation[edit]

  • IUCN: Least Concern
  • American Fisheries Society: Vulnerable
  • Species of Greatest Conservation Need: Florida

Status reviews[edit]

Taylor (1999) is the last status review for the species.

See also[edit]

References[edit]

  1. ^ Ong, K. J.; Stevens, E. D.; Wright, P. A. (2007). "Gill morphology of the mangrove killifish (Kryptolebias marmoratus) is plastic and changes in response to terrestrial air exposure". Journal of Experimental Biology 210 (7): 1109. doi:10.1242/jeb.002238.  edit
  2. ^ "Tropical fish can live for months out of water", Reuters, Wed Nov 14, 2007 9:05pm GMT
  3. ^ "The fish that can survive for months in a tree", Daily Mail, 17 October 2007
  4. ^ "Tropical fish can live for months out of water", Reuters, Nov 14, 2007 9:05pm GMT
  5. ^ http://www.livescience.com/38005-tail-flipping-fish-hops-on-land-video.html
  6. ^ Lublnski, B. A.; Davis, W. P.; Taylor, D. S.; Turner, B. J. (1995). "Outcrossing in a Natural Population of a Self-Fertilizing Hermaphroditic Fish". The Journal of Heredity 86 (6): 469–473. 
  7. ^ MacKiewicz, M.; Tatarenkov, A.; Turner, B. J.; Avise, J. C. (2006). "A mixed-mating strategy in a hermaphroditic vertebrate". Proceedings of the Royal Society B: Biological Sciences 273 (1600): 2449. doi:10.1098/rspb.2006.3594.  edit
  8. ^ http://www.jstor.org/discover/10.2307/1447566?uid=3739216&uid=2&uid=4&sid=21102575838523
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was included in the genus Rivulus; Catalog of Fishes and Page and Burr (2011) included it in the genus Kryptolebias.

The genus Rivulus and several others were placed in the family Rivulidae by Parenti (1981) (a phylogenetic and biogeographic analysis of cyprinodontiform fishes based on morphology). Nelson (1984, 1994) and the 1991 AFS checklist (Robins et al. 1991) recognized the family Aplocheilidae (including the family Rivulidae of Parenti 1981) as distinct from the Cyprinodontidae, in which the genus Rivulus formerly was placed. Murphy et al. (1999) recognized Rivulidae as a distinct family.

MtDNA data indicate that the genus Rivulus, as currently defined, is paraphyletic and in need of further study and taxonomic revision.

Rivulus ocellatus Hensel, 1868, is a senior synonym of R. marmoratus Poey, 1880, but the 1991 AFS checklist retained marmoratus as the specific name pending a decision by the ICZN on a petition to conserve the name marmoratus (see comments in the 1991 Bull. Zool. Nomen. 48(2):150-151). In 1995, the ICZN determined that Rivulus marmoratus is to be given precedence over R. ocellatus whenever the two names are considered to be synonyms.

See Taylor and Snelson (1992) for a discussion of the possibility that South American populations are not conspecific with those in the northern part of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!