Overview

Comprehensive Description

Biology

A common inshore bottom-dweller (Ref. 13575). Feeds on invertebrates (Ref. 13575). Oviparous (Ref. 50449). Utilized for human consumption (Ref. 13575). Minimum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Eastern Indian Ocean and western central Pacific: Malaysia, Singapore, Myanmar, Thailand, Indonesia (Sumatra, Java, between Celebes and New Guinea), Borneo (Sarawak), Viet Nam (Compagno 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Thailand, Malaysia and Indonesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

60.0 cm TL (male/unsexed; (Ref. 13575))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Caudal fin with a pronounced subterminal notch but without a ventral lobe (Ref. 13575). Juveniles with dark grey-brown bands outlined in black, adults uniform medium- to dark-brown color, the black edgings being the last parts of the color pattern to disappear (Ref. 13575).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found close inshore to 12 m depth on sandy, muddy bottoms. This shark is 9?12 cm when born and grows to a maximum length of 61 cm TL (Compagno 2001). Males mature at 44?54 cm TL. Oviparous, with eggs hatching in about December (Compagno 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 12 - ? m (Ref. 43278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A common inshore bottom-dweller. Feeds on invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chiloscyllium hasseltii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chiloscyllium hasseltii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATNTTNGGTGCATGAGCAGGAATAGTAGGTATAGCTCTTAGCCTCTTAATTCGNGNNGAANTAAGTCAACCTGGGTCCCTTCTAGGTGATGACCAGATTTATAATGTAATCGTAACAGCTCATGCTTTCGTAATAATCTTCTTTATGGTAATGCCTGTAATAATTGGTGGATTTGGAAATTGACTAGTACCCCTGATAATCGGCGCACCTGATATAGCTTTTCCTCGAATAAACAATATAAGCTTTTGATTACTTCCCCCTTCATTCTTATTACTCTTAGCCTCTGCAGGAGTTGAAGCTGGGGCAGGAACAGGCTGAACTGTCTACCCACCTTTAGCAGGTAATTTAGCACATGCAGGAGCATCAGTTGATCTAACTATTTTCTCCCTACACTTAGCAGGAATCTCATCAATTTTAGCCTCTATTAATTTTATCACAACTATCATTAATATAAAACCACCAGCAATTTCTCAATATCAAACACCTCTATTTGTTTGATCCATCCTTGTAACTACTATTCTTCTACTACTTTCATTACCTGTTTTAGCAGCAGGCATTACAATGTTACTTACAGACCGAAACTTAAATACAACATTCTTTGATCCAGCAGGAGGAGGCGATCCTATTCTATATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
White, W.T.

Reviewer/s
Stevens, J.D., Valenti, S.V. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
The Indonesian Bambooshark (Chiloscyllium hasselti) is a small, inshore, benthic shark known from Malaysia, Singapore, Myanmar, Thailand, Indonesia, Borneo and Vietnam. The reproductive and population biology of this species are poorly known. No specific data are available on catches or population trends, but it is regularly taken in fisheries throughout its range, and is likely to be threatened by population decline resulting from overfishing, destructive fishing practices and habitat modification, including the damage and destruction of coral reefs. Such threats are likely to increase in the future. As a result of these combined factors, this species is assessed as Near Threatened based on inferred continuing population declines approaching 30% in three generations (possibly ~27 years). There is a need for survey and appraisal of population trends and catch in fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available. Rare in Indonesia, but more common in catches in Borneo.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Taken in inshore fisheries off Singapore, Thailand, Indonesia and Borneo, and utilised for food. Likely to be threatened by overfishing, destructive fishing practices and habitat modification, including the damage and destruction of coral reefs throughout much of its range.

It is one of the ten most important shark species captured in Malaysian fisheries, using trawl gear, where it is consumed locally and also exported to markets in Hong Kong and Taiwan, Province of China (SEAFDEC 2006). It is also known to be captured, consumed and marketed in Thailand (SEAFDEC 2006). The flesh is marketed fresh for human consumption.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures currently in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hasselt's bamboo shark

Hasselt's bamboo shark, Chiloscyllium hasseltii, is a bamboo shark in the family Hemiscylliidae found around Thailand, Malaysia and Indonesia, between latitudes 23° N and 10° N, and longitude 91° E and 133° E; residing inshore. Its length is up to 60 cm.

Features: Much like Chioscyllium punctatum adults usually have not color patterns yet the juveniles have transverse dark bands with black edging.[1]

Reproduction: These sharks are Oviparous. The eggs will attach to benthic marine plants and hatch in December. Their average size at hatching is 94 to 120 mm.[2]

See also[edit]

References[edit]

  1. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 172.
  2. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 172.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!