Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The Orange Bellowsfish (Notopogon fernandezianus, formerly Centriscus fernandezianus) is found in the southwestern Pacific, off southeastern Australia and New Zealand (Glover 1994), and has a limited distribution off southern South America in the southeastern Pacific and southwestern Atlantic between northern Argentina and Uruguay (Duhamel 1995). It occurs at depths of 150 to 580 metres (490 to 1,900 ft). Orange Bellowsfish may reach 18 cm in length.

(Fishwise; Fishbase; Eschmeyer and Fricke 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sara Eckert and Leo Shapiro

Supplier: Sara Eckert

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Occurs on the continental shelf and slope. Identification of Notopogon species are difficult because body shape and development change with age and perhaps sex (Ref. 9563).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southeast Pacific and Southwest Atlantic: Southwest Pacific: Southeast Pacific: Juan Fernández Is, Nazca Ridge and Sala-y-Gomez, Chile. Southwest Atlantic: From Southern Brazil to northern Argentina (Ref. 42513). Previous reports from New South Wales and Victoria (Australia) and New Zealand are misidentifications for Notopogon xenosoma Regan, 1914 (Ref. 42513).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southeastern Pacific and southwestern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 17; Analspines: 0; Analsoft rays: 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 180 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 9563))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Six oblique purplish-blue bands on each side of body, ground color of body silvery white. Gill cover and subocular region silvery. Upper parts of head and snout dark blue. Fins semitransparent (Ref. 27363).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 150 - 580 m (Ref. 9563)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 31 specimens in 1 taxon.
Water temperature and chemistry ranges based on 20 samples.

Environmental ranges
  Depth range (m): 107 - 538
  Temperature range (°C): 10.120 - 17.077
  Nitrate (umol/L): 4.573 - 18.976
  Salinity (PPS): 34.411 - 35.811
  Oxygen (ml/l): 4.361 - 5.125
  Phosphate (umol/l): 0.508 - 1.313
  Silicate (umol/l): 3.029 - 11.709

Graphical representation

Depth range (m): 107 - 538

Temperature range (°C): 10.120 - 17.077

Nitrate (umol/L): 4.573 - 18.976

Salinity (PPS): 34.411 - 35.811

Oxygen (ml/l): 4.361 - 5.125

Phosphate (umol/l): 0.508 - 1.313

Silicate (umol/l): 3.029 - 11.709
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 150 - 580m.
From 150 to 580 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Notopogon fernandezianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACTGCCCTCAGCTTACTAATCCGAGCAGAACTAAGCCAACCAGGCGCCCTGCTTGGAGACGACCAGATTTATAACGTAATTGTTACGGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGCTTTGGTAACTGGCTTATTCCCCTAATGATTGGAGCACCCGACATGGCATTCCCCCGAATGAACAACATGAGCTTTTGATTACTCCCTCCCTCATTCCTTCTGCTCTTAGCCTCTTCAGGAGTTGAAGCAGGTGCTGGCACCGGCTGAACAGTCTACCCTCCACTCTCAGGAAACCTCGCCCACGCTGGGGCCTCTGTTGATTTAACCATCTTCTCACTCCACTTAGCCGGTATTTCATCTATCTTAGGAGCCATCAATTTCATCACGACCATCATTAACATGAAGCCTCCTGCTATTTCACAATATCAGACACCCCTGTTTGTCTGAGCAGTATTAATTACAGCTGTCCTTCTACTTCTTTCCCTGCCTGTCTTAGCCGCCGGGATCACAATGCTTCTCACGGACCGAAATCTAAACACCACTTTCTTTGATCCCGCAGGTGGAGGAGACCCCATCCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Notopogon fernandezianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Orange bellowsfish

The orange bellowsfish, Notopogon fernandezianus, is a species of fish of the family Centriscidae, found in all southern oceans, at depths of 150 to 580 metres (490 to 1,900 ft). Its length is up to 18 cm (7.1 in).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!