Overview

Brief Summary

Biology

Little is known about the big skate's mating behaviour but, like other skates, it is oviparous, or egg-laying, but it has unusually large egg capsules that contain up to seven eggs. Among skates, only the big skate and the closely related Raja pulchra have more than one egg per egg capsule. The egg capsules of the big skate are laid in pairs and usually contain three to four eggs, although up to seven have been recorded. Hatchlings are released from the egg capsule about nine months after being laid by the female. Males reach sexual maturity at approximately seven to eight years, females at 12 to 13 (4). The big skate feeds on marine invertebrates such as shrimps, worms and clams, as well as on crustaceans and fish (3) (4). The positioning of the mouth on the underside of the body is perfect for sucking up animals hiding in the sand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Aptly named, the big skate is the largest skate in North American waters (4). As with all skates, the body is flattened and disc-shaped, with the pectoral fins broadly expanded and joined to the head and body (5). In this species, the tip of the snout and tips of the pectoral fins are acutely pointed, forming a diamond-shaped disc (4) (5). The tail is distinctly demarcated from the disc, relatively narrow, and about as long as body length (5). An irregular row of approximately 33 thorns run from the end of the back, down the tail to the first of two dorsal fins. The small eyes are positioned on the upper surface relatively far back, while the mouth appears on the underside, along with the five gill slits (4). Mottled colouration on the back includes browns, reddish-browns, dark greys and blacks, with occasional small pale spots and scattered dark blotches (4), while the underside is white (6). The species' name 'binoculata' means two eyes, referring to the prominent dark ocellus (eye-like spot) on the upper surface of each pectoral fin (4). Biologists believe this illusion of eyes may confuse potential predators by making the skate appear much larger than it is (4) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Raja binoculata Girard, 1854 ZBK

Description: The egg cases of Raja binoculata ZBK (Figure 8) are perhaps the most distinctive skate egg case found in the ENP. The dorsal surface is convex with two prominent ridges; no other known ENP skate egg case has these ridges. These are very large egg cases, 210 to 280 mm in length from anterior to posterior apron borders, with a MAW about 52% of ECL. Egg case surface very smooth, without striations or fibrous covering. Under magnification the surface appears smooth and without striations. LKW very broad, about 30-33% of MAW, narrowing to about 4-6% at MIW, and extending length of egg case including outer edge of horns; keels also along inner edge of horns. Attachment fibers not present. Anterior apron border broad, slightly concave, fraying along edge, anterior horns about 28-30% of ECL, curving dorsally, with tips flattening and curling toward egg case. Posterior apron broad, transverse, and fraying at edge, its width less than that of anterior. Posterior horns short, stout, about 32-38% ECL, horn base width about 24% of horn length; horns curved, and flattening towards tips. Lateral keels extend beyond horn length. Color of egg case after preservation a dark brown to greenish brown.

Remarks: The egg case of R. binoculata ZBK is perhaps the largest egg case of any known skate species, with a maximum known length, excluding horns, exceeding 300 mm (Hitz, 1964). Raja binoculata ZBK is the only skate species, except for R. pulchra Liu, 1932 ZBK , known to have multiple embryos per egg case. These skates may have 2-7 embryos, with an average of 3-4 per egg case (Hitz, 1964). The Japanese endemic R. pulchra ZBK is known to have 1-5 embryos per egg case (Ishiyama, 1958b). Although it has not been studied in detail, increased fecundity, due to multiple oviparity, in these species may have significant conservation implications. Raja binoculata ZBK is known to produce up to 360 egg cases per year in captivity (Kevin Lewand, Monterey Bay Aquarium, pers. comm.). Assuming an average of 3.5 embryos per egg case the annual fecundity may reach 1,260 neonates, or more, making it one of the most fecund of all elasmobranchs.

Material examined: CAS 224341, northern California ( 38.033 N , - 123.1237 W ), 78 m, 24 September 2004 ; MLML RB 102403-4-06, 146.7 cm TL, central California ( 36.4076 N , - 121.5276 W ), 69 m, 22 October 2003 ; MLML EX 58, southern Oregon ( 44.311 N , - 124.257 W ), 71 m, 4 September 2004 .

  • David A. Ebert, Chante D. Davis (2007): Descriptions of skate egg cases (Chondrichthyes: Rajiformes: Rajoidei) from the eastern North Pacific. Zootaxa 1393, 1-18: 10-11, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:0C16005C-21BC-4252-823E-C83515FCFF28
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: skate (English), raya (Espanol)
 
Raja binoculata Girard, 1855



Big skate

Rhomboidal disc of flattened, pointed head, body and pectoral fins; front edges of disc straight;  snout hard, long, bluntly pointed, triangular; large spiracles behind eyes; pelvic fins with 2 distinct lobes, rear one large, with a weak notch; spines on rear borders only of ventral side; 2 small dorsal fins at rear of tail, no tail fin; spines around eyes (buried in skin in large fish), none on shoulders, 1 on mid-back, a central row from (or behind) pelvic fins backward along tail; large adults with small denticles on upper surface.

Upper surface grey, brown, red-brown to black, with  many small white spots, sometimes forming rosettes; dark mottling and two prominent eyespots; lower surface pale, sometimes with dark blotches.

Size: 244 cm.

Habitat: soft bottom.

Depth: 1-800 m.

Alaska to Baja and the western Gulf of California.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Largest skate in North America (Ref. 2850). Feed on crustaceans and fishes (Ref. 6885). Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 22.8-30.5 cm long and 11.0-19.4 cm wide (Ref. 41249, 41300, 41357). Pectoral fins utilized for human consumption (Ref. 2850). Marketed fresh and frozen; eaten fried and baked (Ref. 9988).
  • McEachran, J.D. and K.A. Dunn 1998 Phylogenetic analysis of skates, a morphologically conservative clade of elasmobranchs (Chondrichthyes: Rajidae). Copeia 1998(2):271-290. (Ref. 27314)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Big Skate is a large rajid found along the western coasts of North America, from the Gulf of California to the Bering Sea and Alaska (Walford 1935, Roedel and Ripley 1950). Although it may be found to depths of 800 m (Martin and Zorzi 1993), it is most common at moderate depths of less than 200 m (Day and Pearcy 1968) and the visual pigments are suited to these comparatively shallow waters (Beatty 1969).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Temperate waters of eastern Pacific Ocean; eastern Bering Sea and Aleutian Islands, west to Unalaska Island and southward off southeastern Alaska, British Columbia, Washington, Oregon, California, and northern and central Baja California (to vicinity of Cedros Island, but rare south of Point Conception, California) (Eschmeyer and Herald 1983, Mecklenburg et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Glubokaya Bay, Cape Navarin, and Stalemate Bank to Cedros Island, Baja California, Mexico.
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in temperate waters of the north-eastern Pacific Ocean from Alaska to central Baja, California (1) (5). This range includes the eastern Bering Sea and Aleutian Islands, west to Unalaska Island and South to Baja, California (U.S.) near Cedros Island (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 800 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 244.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2440 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

244 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 91.0 kg (Ref. 2850)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal fins well back on tail, small; caudal and anal fins absent; pectorals broad, attached to snout and incorporated with body; pelvic fins large, moderately concave on free margins (Ref. 6885). Posterior sides of tail with a small fleshy keel on either side (Ref. 6885).
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Big Skate attains a maximum total length (TL) of 240 cm, although specimens over 180 cm TL (90 kg) are unusual (Martin and Zorzi 1993). Zeiner and Wolf (1993) examined 171 specimens and reported on the weight¬length relationship, maturity and growth parameters. Males were found to mature at 100-110 cm TL (10-11 years) and females at more than 130 cm TL (10-12 years). The fecundity has not been determined.

The reproductive biology of Big Skate is unusual in that it produces large egg cases that contain multiple (1-7) embryos (DeLacy and Chapman 1935, Hitz 1964). There is some evidence that spawning beds are used, and Hitz (1964) reported that large numbers of eggs may be caught by scallop dredge. He observed that egg cases were most abundant at a depth of 60-65 m, and in one instance 152 cases were taken in one 30 minute drag. Hitz (1964) recorded two spawning beds, each at 35 fathoms (64 m), one off Tillamook Head and the other between the Siuslaw and Siltcoos Rivers. Several embryological studies have been undertaken on D. binoculata (e.g., Manwell 1958, McConnachie and Ford 1966, Read 1968, Ford 1971, Evans and Ford 1976). These have utilised egg cases taken off Comox, at 16 fathoms (29 m) off Tsawassen in the Straits of Georgia, British Columbia and from the waters of the San Juan Islands.

Although little is known about the absolute abundance of Big Skate, there have been several published accounts of its comparative abundance. Ebert (1986) captured nine specimens by rod and line in San Francisco Bay and this species accounted for 2% (by number) of the elasmobranch assemblage in this area. The demersal fish assemblages of Oregon have been well studied (Day and Pearcy 1968, Pearcy et al. 1989, Stein et al. 1992). Day and Pearcy (1968) captured 7,689 fish from 67 species and of these, only four specimens of D. binoculata were recorded (0.05% of the catch) and these were taken in water of less than 200 m depth. Pearcy (1989) studied the ichthyofauna of the Heceta Bank, Oregon, using a submersible and, over 16 dives, observed four specimens of D. binoculata. By numbers, Big Skate accounted for approximately 0.1-0.8% of the fish assemblage (Pearcy et al. 1989). More recently, Stein et al. (1992) undertook a similar survey and recorded 10 specimens, most of which were found on mud or mud/boulder substrates.

The ichthyofauna of British Columbia has been well documented and in these waters D. binoculata is relatively abundant. Fargo and Tyler (1991) reported on the species compositions of four distinct fish assemblages (Reef Island, Butterworth, Bonilla and Moresby Gully) and D. binoculata was found to be an important member of the Reef Island assemblage (Perry et al. 1994), constituting 0.10-0.17% of the biomass (Fargo and Tyler 1991). In British Columbian waters, D. binoculata favours shallow (26-33 m) and warmer (7.6-9.4°C) waters (Perry et al. 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Often on sandy or muddy bottoms, sometimes in low stands of kelp, in bays, estuaries, and on continental shelf at depths of 3-800 m, usually less than 200 m (Mecklenburg et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 3 - 800 m (Ref. 6793), usually 3 - 110 m (Ref. 2850)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 72 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 8 - 3822
  Temperature range (°C): 6.630 - 9.015
  Nitrate (umol/L): 8.119 - 30.351
  Salinity (PPS): 32.561 - 33.890
  Oxygen (ml/l): 2.565 - 5.656
  Phosphate (umol/l): 1.102 - 2.545
  Silicate (umol/l): 13.547 - 46.900

Graphical representation

Depth range (m): 8 - 3822

Temperature range (°C): 6.630 - 9.015

Nitrate (umol/L): 8.119 - 30.351

Salinity (PPS): 32.561 - 33.890

Oxygen (ml/l): 2.565 - 5.656

Phosphate (umol/l): 1.102 - 2.545

Silicate (umol/l): 13.547 - 46.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 800m.
From 3 to 800 meters.

Habitat: demersal. Found at moderate depths. Feeds on crustaceans and fishes. Up to 7 embryos per egg case. Largest skate in North America. The sides of the disk are utilized for human consumption (Ref. 2850). Marketed fresh and frozen; eaten fried and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurring along the coast in estuaries, bays and over the continental shelf. Commonly found on sandy and muddy bottoms to depths of 120 m (2) (4). Usually seen lying on the bottom partially covered with bottom sediments, with eyes protruding above the remainder of the body and sediments (4) (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on fish and crustaceans (Ref. 2850).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on shrimp, worms, clams, and other invertebrates, as well as sculpins and other fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Up to 7 embryos per egg case (Ref. 2850). Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Benthic, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Raja binoculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTACTTGATTTTTGGTGCCTGAGCAGGCATGGTCGGAACTGGCCTAAGTCTTTTAATCCGGGCAGAACTGAGTCAACCTGGTACACTCCTGGGCGATGATCAAATTTATAATGTCATTGTTACAGCCCATGCCTTAGTGATGATCTTTTTTATGGTTATACCAATTATAATCGGGGGATTTGGCAATTGACTCGTCCCTTTAATAATTGGCTCCCCAGACATAGCCTTTCCCCGCATAAATAATATAAGTTTTTGACTTCTACCTCCCTCTTTCCTCCTCCTCTTGGCCTCTGCCGGGGTAGAAGCCGGGGCCGGGACAGGTTGAACTGTATACCCACCCTTGGCAGGGAATATAGCCCACGCGGGGGCCTCCGTGGACTTAACAATTTTCTCTCTTCATCTAGCAGGTGTTTCATCTATCCTGGCCTCCATTAACTTCATCACCACAATTATTAATATAAAACCGCCAGCAATCTCTCAATACCAAACACCTTTATTCGTATGATCAATTCTTGTTACAACTGTCTTACTTCTTATAGCCCTCCCAGTCCTAGCAGCCGGCATTACTATACTACTCACGGATCGTAATCTCAATACAACTTTCTTTGACCCAGCAGGAGGAGGGGACCCCATCCTATACCAACACTTATTCTGATTCTTCGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Raja binoculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Ellis, J. & Dulvy, N.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

This large-bodied demersal skate occurs in the north-eastern Pacific, from California to Alaska. The Big Skate (Raja binoculata) has not been subject to meaningful study and there are insufficient data on the population to determine its status. It is, however, one of the larger species of skate and, as with the Common Skate (Dipturus batis) and Barndoor Skate (D. laevis), may be susceptible to overfishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Wide range in the temperate eastern Pacific Ocean; likely declining in abundance as a result of commercial exploitation, but better information is needed on population trends.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk/near threatened on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In Californian waters the species is, with the California skate Dipturus inornata and longnose skate Raja rhina, one of the three most important rajids in commercial and recreational fisheries (Roedel and Ripley 1950, Martin and Zorzi 1993) and is a bycatch from trawlers, longline and trammel nets (Zeiner and Wolf 1993). Martin and Zorzi (1993) analysed trends in the commercial landings of skates from 1916-1990 and reported that annual landings of Rajidae spp. Ranged from 22.9-286.3 t. Since 1916, rajids have constituted 11.8% of the total weight of elasmobranchs landed (ranging from 1.9-89.5% annually). The skates that are landed in the Californian fishery have tended to be juvenile fish (Roedel and Ripley 1950, Martin and Zorzi 1993), with larger individuals being discarded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: This skate matures at a late age, grows slowly, and has a low reproductive rate; it is potentially vulnerable to overfishing. Big skates are taken in targeted skate fisheries and incidentally as bycatch primarily by bottom trawlers (increasingly they are retained for sale as "skate wings" or "scallops"), but there is insufficient information on the impact of this on populations of this species. See National Marine Fisheries Service (12 May 2004, Fisheries of the Exclusive Economic Zone Off Alaska; Skates Management in the Groundfish Fisheries of the Gulf of Alaska. Federal Register 69(92):26313-26320). See also Bester, Florida Museum of Natural History, at http://www.flmnh.ufl.edu/fish/Gallery/Descript/BigSkate/BigSkate.html.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The big skate is fished for its fins, which are marketed fresh and frozen (3), but is only of minor importance to commercial fisheries (4). However, this species is also taken incidentally as bycatch, primarily by bottom trawlers in the waters off the coast of California (U.S). Indeed, during the 1990s, the skate catch off the coast of California increased nearly ten-fold, partly targeted and partly taken as bycatch by trawl fisheries that supplement their income by marketing incidentally caught skates and rays (4). Data are currently inadequate to determine the precise impact fisheries are having on big skate populations, but as one of the larger, slow maturing species with a low reproductive rate, this skate is potentially vulnerable to population collapses caused by over-fishing (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Presently, this skate is classified only as Lower Risk/near threatened (LR/nt) on the IUCN Red List 2004, and no direct conservation measures are currently in place for the species (1). However, more population data and close monitoring of this species are required to accurately assess the impact fisheries are having on its abundance and distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Big skate

This article is about the fish. For other uses, see skate (disambiguation).

The big skate (Raja binoculata) is the largest species of skate (fish), family Rajidae, in the waters off North America. They are found along the Pacific coast from Alaska to Baja California, typically from the intertidal zone to a depth of 120 m (390 ft), and feed on benthic invertebrates and small fishes. They are unusual among skates in that their egg cases may contain up to seven eggs each. This species is one of the most commercially important skates off California and is sold for food.[2]

This species was described by Charles Frédéric Girard in 1855; its specific epithet binoculata is derived from the Latin bi meaning "two", and oculatus meaning "eyed", referring to the two prominent eyespots on its wings. Girard also described what would later be determined to be a junior synonym of R. binoculata, R. cooperi, based on notes made by James G. Cooper on a decaying big skate found ashore near the entrance of Shoalwater Bay, Washington.[3] In some older literature, this species is placed in the genus Dipturus.[4]

Distribution and habitat[edit]

The big skate is found in the northeastern Pacific Ocean, from the eastern Bering Sea and the Aleutian Islands, as far south as Cedros Island off central Baja California. It is rare south of Point Conception, California. It occurs in coastal bays, estuaries, and over the continental shelf, usually on sandy or muddy bottoms, but occasionally on low strands of kelp. Though reported to a depth of 800 m (2,600 ft), it is usually found no deeper than 120 m (390 ft). It frequents progressively shallower water in the northern parts of its range.[2][3] This species is abundant off British Columbia, where it prefers a depth of 26–33 meters (85–108 ft) and a temperature of 7.6–9.4 °C (45.7–48.9 °F).[5]

Description[edit]

The maximum known length of a big skate is 2.4 m (7.9 ft), though this species usually does not exceed 1.8 m (5.9 ft) and 91 kg (201 lb). This species has a flattened, diamond-shaped pectoral fin disk slightly wider than it is long, with a long, moderately pointed snout. The eyes are small and placed just ahead of the large spiracles. The teeth are small with raised cusps, numbering 24-48 rows in the upper jaw and 22-45 in the lower. Two small dorsal fins are on the tail, the anal fin is absent, and the caudal fin is reduced to a simple fold. There is a weak notch in each pelvic fin.[2][3]

A juvenile has smooth skin, while an adult has small prickles on its dorsal surface and the underside of the snout, between the gill slits, and on the abdominal region. It has two or three thorns on the middle of the back, a row of 12-55 (usually 13-17) thorns along the midline of the tail, and an interdorsal thorn. Some older individuals have a thorn above each eye. The back is colored a mottled brown to reddish brown, olive-brown, or gray, with rosettes of small white spots or scattered dark blotches. Two large dark spots with pale borders occur, one on each wing. The ventral side is white, sometimes with dark spots or blotches.[2][3]

Biology and ecology[edit]

A male big skate resting on the sea floor off Mt. Pinos

Big skates are usually seen buried in sediment with only their eyes showing. They feed on polychaete worms, molluscs, crustaceans, and small benthic fishes. Polychaetes and molluscs comprise a slightly greater percentage of the diet of younger individuals. A known predator of big skates is the broadnose sevengill shark (Notorhynchus cepedianus); the eyespots on the skates' wings are believed to serve as decoys to confuse predators. Juvenile northern elephant seals (Mirounga angustirostris) are known to consume the egg cases of the big skate. Known parasites of the big skate include the copepod Lepeophtheirus cuneifer.[2][3]

The egg capsule ("mermaid's purse") of a big skate

This species is oviparous, and is one of the few skate species that typically has more than one embryo within each egg capsule, commonly called "mermaid's purses" when they are found washed up on beaches. The egg capsule of a big skate is the largest of any skate, measuring 23–31 cm (9–12 in) long and 11–19 cm (4–7 in) wide. Each capsule is oblong in shape and has a highly arched dorsal surface, nearly flat ventral surface, and parallel lateral edges that become somewhat concave towards the center of the case. At the corners of the case, there are four blunt, broad horns with the posterior pair being slightly longer. A single egg capsule may contain one to seven (usually three or four) eggs.[3]

The female deposits her eggs in pairs on sandy or muddy flats; there is no discrete breeding season and egg-laying occurs year-round.[3] Females may use discrete spawning beds, as large numbers of egg cases have been found in certain localized areas.[5] The young emerge after 9 months and measure 18–23 cm (7–9 in). Female big skates mature at 1.3–1.4 m (4 ft 3 in–4 ft 7 in) long and 12–13 years old, while males mature at 0.9–1.1 m (2 ft 11 in–3 ft 7 in) long and seven to eight years old.[2] The growth rate of big skates in the Gulf of Alaska are comparable to those off California, but differ from those off British Columbia. The lifespans of big skates off Alaska are up to 15 years, while those off British Columbia are up to 26 years.[6][7]

Relationship to humans[edit]

Big skates are frequently caught by recreational anglers, who usually release or discard them. They adapt well to captivity and are often displayed in public aquaria. This species is one of the three most important skates fished off the coast of California, though compared to other commercial fisheries, it is of only minor importance. This species is usually taken as bycatch in bottom trawls; the pectoral fins are sold as "skate wings" and are eaten baked or fried, often being labeled as imitation scallops. In the 1990s, the market value of skate wings rose to US$0.40-$1.00 per pound, and catches of the big skate off California increased tenfold as the trawl fishery began marketing its skate and ray bycatch.[2] In 2003, a targeted fishery for the big skate and the longnose skate (Raja rhina) commenced in the Gulf of Alaska.[6] Population data following this increased exploitation are lacking, but the big skates' slow reproductive rate has led them to be assessed as Near Threatened by the World Conservation Union.[1]

References[edit]

  1. ^ a b Ellis, J. and Dulvy, N. (2000). Raja binoculata. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved March 7, 2009.
  2. ^ a b c d e f g Bester, C. Biological Profiles: Big Skate. Florida Museum of Natural History Ichthyology Department. Retrieved on March 7, 2009.
  3. ^ a b c d e f g Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. London: University of California Press. ISBN 0-520-23484-7. 
  4. ^ Froese, Rainer and Pauly, Daniel, eds. (2009). "Raja binoculata" in FishBase. March 2009 version.
  5. ^ a b IUCN/SSC Shark Specialist Group (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. IUCN. ISBN 2-8317-0700-5. 
  6. ^ a b Gburski, C.M., Gaichas, S.K. and Kimura, D.K. (October 2007). "Age and growth of big skate (Raja binoculata) and longnose skate (R. rhina) in the Gulf of Alaska". Environmental Biology of Fishes 80 (2-3): 337–349. doi:10.1007/s10641-007-9231-8. 
  7. ^ McFarlane, G.A. and King, J.R. (2006). "Age and growth of big skate (Raja binoculata) and longnose skate (Raja rhina) in British Columbia waters". Fisheries Research 78 (2-3): 169–178. doi:10.1016/j.fishres.2006.01.009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!