Asymbolus parvus — Details

Dwarf Catshark learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Oviparous (Ref. 50449).
  • Compagno, L.J.V., J.D. Stevens and P.R. Last 1999 Australian spotted catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). Part 1: Descriptions of three new species from western Australia. p. 2-18. In P.R. Last (ed.). Australian catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). (Ref. 36712)   http://www.fishbase.org/references/FBRefSummary.php?id=36712&speccode=57511 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Northwestern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Eastern Indian Ocean: Western Australia.
  • Compagno, L.J.V., J.D. Stevens and P.R. Last 1999 Australian spotted catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). Part 1: Descriptions of three new species from western Australia. p. 2-18. In P.R. Last (ed.). Australian catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). (Ref. 36712)   http://www.fishbase.org/references/FBRefSummary.php?id=36712&speccode=57511 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

Asymbolus parvus is restricted to a confined region in northwestern Australia between Dampier and the Buccaneer Archipelago off the coast of Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Size

Max. size

Learn more about this article

34.9 cm TL (male/unsexed; (Ref. 36712)); 35.7 cm TL (female)
  • Compagno, L.J.V., J.D. Stevens and P.R. Last 1999 Australian spotted catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). Part 1: Descriptions of three new species from western Australia. p. 2-18. In P.R. Last (ed.). Australian catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). (Ref. 36712)   http://www.fishbase.org/references/FBRefSummary.php?id=36712&speccode=57511 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Very small, distinctive, pale brown body with many white spots and blotches; dark brown or black spots absent. Caudal peduncle relatively thin; low anal fin. Preoral length long. Teeth very small, ridged with 5-7 cusps; small, densely imbricated, weakly tricuspidate denticles. Monospondylous centra 34-35.
  • Compagno, L.J.V., J.D. Stevens and P.R. Last 1999 Australian spotted catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). Part 1: Descriptions of three new species from western Australia. p. 2-18. In P.R. Last (ed.). Australian catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). (Ref. 36712)   http://www.fishbase.org/references/FBRefSummary.php?id=36712&speccode=57511 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

pelagic-oceanic; marine; depth range 160 - 260 m (Ref. 36712)
  • Compagno, L.J.V., J.D. Stevens and P.R. Last 1999 Australian spotted catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). Part 1: Descriptions of three new species from western Australia. p. 2-18. In P.R. Last (ed.). Australian catsharks of the genus Asymbolus (Carcharhiniformes: Scyliorhinidae). (Ref. 36712)   http://www.fishbase.org/references/FBRefSummary.php?id=36712&speccode=57511 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology
A. parvus is found in depths ranging from 59 to 252 m. This species grows to approximately 33 cm total length (TL), with males maturing at about 28 cm TL. This is a tropical species that is most commonly found on the outer continental shelf. The biology of this species is almost entirely unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 162 - 256
  Temperature range (°C): 13.134 - 20.374
  Nitrate (umol/L): 10.770 - 23.995
  Salinity (PPS): 34.627 - 34.995
  Oxygen (ml/l): 2.438 - 3.016
  Phosphate (umol/l): 0.979 - 1.702
  Silicate (umol/l): 15.661 - 35.232

Graphical representation

Depth range (m): 162 - 256

Temperature range (°C): 13.134 - 20.374

Nitrate (umol/L): 10.770 - 23.995

Salinity (PPS): 34.627 - 34.995

Oxygen (ml/l): 2.438 - 3.016

Phosphate (umol/l): 0.979 - 1.702

Silicate (umol/l): 15.661 - 35.232
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

 

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs on the continental shelf and slope (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Asymbolus parvus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAATTTTTGGTGCATGAGCAGGAATAGTTGGAATAGCTTTAAGTTTACTAATTCGCGCTGAACTAGGTCAACCGGGGTCTCTTTTAGGAGATGATCAGATTTACAATGTGGTCGTAACTGCCCATGCCTTTGTAATAATCTTTTTTATAGTTATACCAGTCATAATTGGCGGCTTTGGAAATTGACTTGTTCCTTTAATAATTGGTGCACCAGACATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTACTTCCGCCTTCTTTCTTACTTCTCTTAGCTTCCGCAGGGGTAGAAGCTGGAGCAGGAACCGGATGAACTGTTTATCCCCCCTTAGCAGGTAATATAGCACATGCTGGGCCCTCTGTTGATTTAGCTATCTTTTCCCTTCATTTAGCTGGTATTTCATCCATTCTAGCCTCAATCAACTTTATTACAACCATTATTAATATAAAACCCCCAGCCATTTCCCAGTATCAAACACCATTATTTGTTTGATCAATTCTTATTACTACCGTTCTTCTTCTTCTTGCCCTCCCAGTTCTAGCAGCAGGAATTACAATATTACTCACAGACCGCAACCTTAATACTACATTCTTTGACCCCGCAGGTGGAGGGGACCCAATCCTTTATCAACACTTAN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Asymbolus parvus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Heupel, M.R. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Simpfendorfer, C.A., Kyne, P.M. & Cavanagh, R.D (Shark Red List Authority)

Justification
This small endemic catshark is recorded from a small area off the northwest coast of Australia with a depth range of 59 to 252 m. Its very small size means that it is unlikely to be significantly impacted by the trawl fisheries in the area. In addition it is probably discarded when caught due to its size and low commercial value, and is believed to have a high survival rate.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population

Learn more about this article

Population
Little is known about the population size in this range and no scientific data are currently available concerning the population size of this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats
This species may be collected as bycatch in commercial fisheries, e.g., the Pilbara Trawl Fishery, but is believed to have high survival rates and is thought to be discarded when caught.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
Currently no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Asymbolus parvus

Learn more about this article

Not to be confused with Scyliorhinus torrei, also known as the dwarf catshark.

The dwarf catshark (Asymbolus parvus) is a cat shark of the family Scyliorhinidae found only off West Australia, at depths of between 200 and 400 m. Its length is up to 44 cm.[1]

References

  1. ^ GBIF.org (Retrieved 2 March 2010)
  • Froese, Rainer, and Daniel Pauly, eds. (2006). "Asymbolus parvus" in FishBase. July 2006 version.
  • Environment-Australian Government
  • Compagno, L.J.V., Dando, M. & Fowler, S. 2005. A Field Guide to the Sharks of the World. London : Collins 368 pp. [208]
  • Last, P.R. & Stevens, J.D. 1994. Sharks and Rays of Australia. Canberra : CSIRO Australia 513 pp. 84 pls figs [172, 181 fig. 26.9 pl. 22] (as Asymbolus sp. A)
  • Last, P.R. & Stevens, J.D. 2009. Sharks and Rays of Australia. Collingwood : CSIRO Publishing Australia 2nd Edn 550 pp. [200]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!