Overview

Comprehensive Description

Early juvenile markings: This species is distinct in the field in having magenta stripes and spots on the head, not strictly blue as in other juvenile damselfishes. This important feature is rarely mentioned in books and guides (in Randall's 2nd edition the

Photograph by Gregory Taylor saltyzoo.com

New recruits (10-15 mm SL) of S. diencaeus have a pattern of magenta stripes and spots on the head and upper body with two spots and a stripe on the iris. There is no additional row of spots between the top stripe on the head and the upper-eye stripe at this stage (this additional row emerges after about 15-20 mm SL, often just three spots in a row). There is a large black ocellus ringed in blue centered on the last three dorsal-fin spines and first three dorsal-fin soft rays (about 50% on the fin, 50% on the body). Although the top of the head and anterior body may be duskier than the rest of the body in new recruits, it is not blue. Ontogenetic homologies include a transient darkening of the scales at the saddle area of the caudal peduncle, a dark spot at the top of the pectoral-fin base, and some darkening of the anterior upper body (but not clearly blue).

Later juveniles (over 20 mm SL) are characterized by magenta stripes on the head and upper body, a relatively uniform yellow body (without obviously blue shading on the anterior upper body and head), a dorsal-fin ocellus distinctly over both the body and fin, no caudal-peduncle saddle spot, and no black spot at the top of the pectoral-fin base.

Occasional problematic individuals do have some blue shading over the top of the head and more than the usual blue spotting and these may be confused with (or hybrids of) S. leucostictus (both species missing the caudal-peduncle saddle). DNA sequence comparisons underway at present should resolve the line of separation.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Adults inhabit coral and rocky reefs of sheltered lagoons and inshore areas. Territorial and pugnacious (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Taken incidentally in traps and small-meshed beach nets (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: southern Florida (USA), Bahamas, and Caribbean Sea. Including Antilles and Yucatan to Venezuela (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 15 - 16; Analspines: 2; Analsoft rays: 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 125 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.5 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: Damselfishes with 12 dorsal-fin spines and a mode of 15-16 dorsal-fin soft rays indicate Stegastes and Microspathodon chrysurus. Fin-ray counts broadly overlap among Stegastes with most species having 13-14 soft anal-fin rays and 18-20 pectoral-fin rays (S. adustus and M. chrysurus have a mode of 21 pectoral-fin rays). Given this overlap, larvae and even early juveniles can require DNA sequencing to reliably distinguish the species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anal fin long and pointed, reaching well beyond base of tail (Ref. 26938). Adults dark gray-brown, the edges of the scales blackish; a wash of yellowish often present dorsally on head, nape, and on back below spinous portion of dorsal fin; a small black spot at upper base of pectoral fins; juveniles bright yellow with two bright blue lines dorsally on head, extending to beneath middle of dorsal fin where they break into spots; a large blue-edged black spot basally on dorsal fin centered on last spine (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Stegastes diencaeus
Catalog Number: USNM 202179
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Starck, J. Starck & A. Emery
Year Collected: 1965
Locality: Florida.: Monroe Co.: 1/3 mi SW Alligator Reef Light. Shallow Ledge of Reef, Monroe County, Florida, United States, Atlantic
Depth (m): 6 to 6
  • Holotype: Emery, A. R. & Burgess, W. E. 1974. Copeia. 1974 (4): 880.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Stegastes diencaeus
Catalog Number: USNM 202180
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Emery
Year Collected: 1966
Locality: Florida.: Monroe Co.: Looe Key Reef, 5 mi. Off Big Pine Key, On Top of Inner Rubble Channels, Monroe County, Florida, United States, Florida Keys, Atlantic
Depth (m): 2 to 3
  • Paratype: Emery, A. R. & Burgess, W. E. 1974. Copeia. 1974 (4): 880.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Juvenile analogues: New recruits of S. diencaeus are separated from S. planifrons and S. adustus by having stripes along with the spots on the head and iris and from S. partitus by having a dorsal-fin ocellus. New recruits of S. diencaeus are most easily separated from the other striped species when the S. diencaeus have no blue wash over the anterior upper body and head, but some individuals do show a dusky anterior coloration and these individuals can be problematic. Other features separating the new recruits from S. leucostictus are having the ocellus half onto the body, the blue ring below the ocellus a continuous line, no additional row of spots between the top stripe on the head and the upper-eye stripe, and sparser spotting on the anterior dorsal fin. New recruits of S. diencaeus can also be separated from S. variabilis by having only a faint caudal-peduncle saddle (if any) but, when compared to recruits of S. variabilis that have not yet developed their saddle, the distinction is difficult without life colors. Unfortunately, some S. diencaeus recruits up to 20 mm SL have some form of faint caudal-peduncle saddle and some S. variabilis of the same size can have similar unformed saddles. In that case, the distinction can become more subtle: S. variabilis have more dusky blue shading over the head and body, especially including the posterior dorsal fin and the anal fin which are not dusky in S. diencaeus. Unfortunately, degrees of duskiness are poor characters to separate individuals. DNA sequence comparisons underway at present should resolve the line of separation.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 2 - 45 m (Ref. 9710), usually 2 - 5 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 39 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 0.5 - 22
  Temperature range (°C): 26.706 - 27.654
  Nitrate (umol/L): 0.174 - 1.786
  Salinity (PPS): 34.880 - 36.594
  Oxygen (ml/l): 4.605 - 4.687
  Phosphate (umol/l): 0.046 - 0.133
  Silicate (umol/l): 1.986 - 3.242

Graphical representation

Depth range (m): 0.5 - 22

Temperature range (°C): 26.706 - 27.654

Nitrate (umol/L): 0.174 - 1.786

Salinity (PPS): 34.880 - 36.594

Oxygen (ml/l): 4.605 - 4.687

Phosphate (umol/l): 0.046 - 0.133

Silicate (umol/l): 1.986 - 3.242
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 45m.
From 2 to 45 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes diencaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATGGTAGGAACAGCTCTAAGTCTCCTCATTCGGGCAGAACTAAGCCAACCCGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATTGTTACGGCGCACGCCTTCGTAATAATCTTCTTTATAGTAATACCCATCATAATCGGAGGATTCGGAAACTGGCTTATCCCCCTGATGATTGGGGCCCCTGATATGGCCTTCCCCCGTATAAACAATATAAGCTTCTGACTTCTTCCTCCTTCCTTCCTTCTTCTGCTTGCCTCTTCAGGTGTAGAAGCAGGGGCAGGAACAGGATGAACAGTCTATCCTCCACTATCTGGTAACCTAGCTCACGCAGGGGCCTCCGTTGACCTAACTATTTTCTCCCTACATTTAGCAGGAATTTCATCCATCCTAGGGGCAATCAACTTTATTACTACTATTATTAACATGAAACCCCCTTCAATCTCCCAATACCAAACCCCTCTCTTTGTATGAGCAGTTCTAATTACCGCTGTACTACTACTCCTCTCCCTTCCCGTCTTAGCTGCCGGCATTACTATGCTCCTTACGGACCGAAACCTTAATACTACTTTCTTTGACCCTGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes diencaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 379
Specimens with Barcodes: 385
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Stegastes diencaeus

Stegastes diencaeus is a damselfish from the Western Atlantic. It occasionally makes its way into the aquarium trade. It grows to a size of 12.5 cm in length.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!