Overview

Comprehensive Description

Biology

Inhabits coastal waters, mostly around coral reefs. Usually seen well above the bottom, frequently in aggregations. Young individuals are usually found over weed beds. Feeds mainly at night (Ref. 9987). Feeds on a combination of plankton and benthic animals including fishes, crustaceans, worms, gastropods and cephalopods. Juveniles feed primarily on plankton (Ref. 9710). Spawning occurs throughout the year, with peaks at different times in different areas (Ref. 26938). Marketed fresh and frozen (Ref. 9987). Has been reared in captivity (Ref. 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ocyurus chrysurus is an elongate, slender, snapper that may grow to 76 cm or more in length and reach 9 pounds, though most are captured at much smaller size. The dorsal fin is continuous, with 10 strong spines, the fifth of which is the longest, and 12-14 soft rays. The anal fin has 3 spines and 8-9 rays, with the third spine longer than the second. The caudal fin is long and deeply forked, with the upper lobe longer then the lower. The pectoral fins are also long, reaching to the anus. Scales are small and ctenoid, with 48-49 lateral line scales. In profile, the dorsal area is only slightly elevated, with a slight curve between the nape and the dorsal fin. The mouth is small in comparison with other snappers and is set obliquely, with the lower jaw projecting beyond the upper. The maxillary extends beyond the front of the orbit. The upper jaw and the vomer each have a narrow band of villiform teeth, with the upper jaw also having 5-6 lateral canine teeth. The lower jaw has larger villiform teeth. The preopercule is weakly serrated, and those at the angle are shallowly emarginated. Body color is distinctive. The dorsal surface is bluish to olive green in color, fading along the sides to white along the ventral surface. A strong yellow stripe runs midlaterally along the sides, originating on the snout and broadening as it runs the length of the body to the depth of the entire caudal peduncle. Yellow spots pepper the upper body above the midlateral stripe. The caudal fin is entirely yellow. The dorsal fin is yellow distally, but pale at its base and anteriorly. All other fins are pale yellow or clear in color (Bortone and Williams 1986).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: extending northward to Massachusetts, USA and Bermuda and southward to southeastern Brazil, in Gulf of Mexico and Antilles (Anderson, pers. comm.). Most common in the Bahamas, off south Florida and throughout the Caribbean. Lutjanus ambiguus (Poey, 1860), an intergeneric hybrid with Lutjanus synagris (Linnaeus) as demonstrated by Loftus (1992: Ref. 33006), followed by McEachran &. Fechhelm (2005: Ref. 78464).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: extending northward to Massachusetts, USA and Bermuda and southward to southeastern Brazil, in Gulf of Mexico and Antilles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the Western Atlantic, Ocyurus chrysurus ranges from approximately Massachusetts south to Brazil including Bermuda, the Gulf of Mexico, West Indies, and the Caribbean. It is most common from South Florida through the Bahamas and Caribbean. Juveniles are common in inshore areas where they utilize seagrass beds as nursery habitats. Adults are found within the India River Lagoon, especially near inlet areas, however, they are more common in nearshore and offshore waters.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 8 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 863 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

86.3 cm TL (male/unsexed; (Ref. 9626)); max. published weight: 4,070 g (Ref. 40637); max. reported age: 14 years (Ref. 3090)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ocyurus chrysurus reaches a maximum size of 86.3 cm (33.9 inches) total length (TL), and may weigh as much as 4.07 kg (8.9 pounds) (IGFA 2001). they are reported to live 14 years or more. Growth rates in yellowtail snapper were reported by Thompson and Munro (1974) as 3.3 mm/month (0.13 inches) based on back calculated lengths at mean annulus formation in otoliths.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head relatively small, lower jaw projecting slightly beyond the upper. Scale rows on back rising obliquely above lateral line. Back and upper sides blue to violet with scattered yellow spots. A prominent mid-lateral yellow band running from the snout to the caudal fin base. The lower sides and belly whitish with narrow reddish and yellow stripes; the dorsal and caudal fins yellow; the anal and pelvic fins whitish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Ocyurus chrysurus is a distinctive species that is not easily confused with other snappers.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 180 m (Ref. 10795), usually 10 - 70 m (Ref. 55229)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1741 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1322 samples.

Environmental ranges
  Depth range (m): 0 - 62
  Temperature range (°C): 23.301 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 4.255 - 4.756
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 62

Temperature range (°C): 23.301 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 4.255 - 4.756

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 180m.
Recorded at 180 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coastal waters, mostly around coral reefs. Usually seen well above the bottom, frequently in aggregations. Young individuals are usually found over weed beds. Feeds mainly at night (Ref. 9987). Feeds on a combination of plankton and benthic animals including fishes, crustaceans, worms, gastropods and cephalopods (Ref. 9710, 26338). Juveniles feed primarily on plankton (Ref. 9710). Carnivore (Ref. 57616). Also cleaned by Pomacanthus paru observed at the reefs of the Abrolhos Archipelago, off eastern Brazil (Ref. 40094).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most snappers are classified as euryphagic carnivores (Bortone and Williams 1986). Ocyurus chrysurus differs somewhat in its feeding behavior from other snappers because it tends to feed above the substratum more than do other species. Randall (1967) reported adults eat crabs (23%), shrimp (16%), and fishes (15.9%). Off Cuba, Piedra (1969) reported yellowtail stomach contents included fish (82%), and shrimp (17%). Smaller fishes, crustaceans, marine worms, gastropods, and cephalopods have also been reported in the diet (Allen 1985).Predators: Primary predators of snappers are sharks and other large predatory fishes including other snappers (Bortone and Williams 1986). Habitats: Ocyurus chrysurus is typically found at water depths of 20-70 m (66 - 230 feet) depths (Thompson and Munro 1974; Fischer 1978), but has been reported to depths from 0-180 m (0 - 590 feet). Juveniles utilize vegetated inshore waters in estuaries and bays and are common in seagrass beds (Starck 1971; Bortone and Williams 1986). Adults generally form schools, but are less associated with hard-bottoms than other snapper species (Randall 1967; Bortone and Williams 1986), inhabiting patch reefs and along the outer edges of deeper coral and rock reefs. Moe (1972) reported yellowtail snappers to be semipelagic wanderers over reef habitats. Adults tend to remain in an area once they have become established (Beaumariage 1969; Bortone and Williams 1986). Activity Time: Ocyurus chrysurus feeds primarily nocturnally (Bortone and Williams 1986).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14 years Observations: Unverified estimates suggest these animals may live up to 19 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Age at maturity is in question for many snapper species, with most authors relating maturity to length. Ocyurus chrysurus males become mature at approximately 26 cm (10.2 inches) fork length (FL), while females mature at 29 - 31cm (11.4 - 12.2 inches) FL (Thompson and Munro 1974). As with most snappers, the yellowtail spawns offshore in groups (Wicklund 1969; Thompson and Munro 1974). The spawning season may be protracted, with seasonal peaks in activity (Erdman 1976). Munro et al. (1973) reported ripe individuals from March through May in nearshore waters off Jamaica, but noted that yellowtail spawn year-round in offshore waters. Off Cuba, Piedra (1969) reported females were ripe between March and August. Allen (1985) reported yellowtail snapper spawning from April to August in the Florida Keys.Fecundity was estimated by Piedra (1969) as 99,660 - 1.5 million eggs per female for Ocyurus chrysurus measuring between 292-382 mm (11.5 - 15.0 inches) FL. Rodriguez-Pino 1961) reported that Ocyurus chrysurus sometimes hybridizes with lane snapper, Lutjanus synagris. They are also thought to hybridize with the dog snapper, L. jocu (Jordan and Evermann 1898).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

As with most snapper species, eggs are pelagic (Bortone and Williams 1986) and hatch after approximately 20 hours.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ocyurus chrysurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGGGCCGGRATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCGCATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTCGGGAACTGACTGATCCCACTAATGATCGGGGCCCCCGATATGGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTCCCGCCATCATTCCTATTGCTACTCGCCTCTTCTGGGGTAGAAGCCGGTGCTGGAACTGGGTGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCACACGCAGGAGCATCTGTAGACCTAACTATTTTCTCCCTGCATCTAGCAGGTGTTTCCTCAATTCTGGGAGCAATCAACTTCATTACAACAATCATCAACATGAAACCTCCTGCCATTTCCCAGTATCAAACGCCCCTATTCGTCTGAGCCGTCCTAATTACTGCTGTTCTACTTCTTCTCTCCCTACCAGTTTTAGCGGCCGGAATTACAATGCTTCTTACAGACCGAAATCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGGGATCCCATCCTCTACCAACATCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ocyurus chrysurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 96
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fisheries Importance:COMMERCIAL FISHERY: The commercial fishery for yellowtail snapper is not especially valuable in east central Florida, though it is considerably more valuable in south Florida where average annual landings total over 1.7 million pounds and are valued at approximately $3.5 million. Data from Florida Fish and Wildlife Research Institute (FWRI) show that landings of yellowtail have changed from being fairly evenly distributed between commercial and recreational fishers from 1982 - 1992, to one more dominated by commercial interests since 1993. On the Atlantic coast of Florida catches have fluctuated without any discernable trend from 1982 - 2000. In recent years, Atlantic coast landings have been somewhat lower, now averaging approximately 167,000 pounds. On the Gulf coast, landings have fluctuated around 1.8 million pounds since 1996. In 2003, FWRI reported that yellowtail snapper landings were 4% lower statewide than in the previous 5 years. The statewide commercial catch of yellowtail snapper, Ocyurus chrysurus, between the years 1987 - 2001 was 51.9 million pounds, with a dollar value of over $25.9 million. Within this time period, 38,001 pounds of yellowtail were harvested commercially in the 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties), with a dollar value of just $73,332 reported. This ranks the yellowtail snapper seventy-fourth in commercial value within the IRL, and eightieth in pounds harvested.Figure 1 below shows the dollar value of the commercial yellowtail snapper fishery to IRL counties by year. As shown, the commercial catch ranged from a low of $2,024 in 1994 to a high of over $11,004 in 1994. St. Lucie County accounts for the largest percentage of the yellowtail snapper catch with 32.3% in total (Figure 2), followed by Volusia County, which accounts for 28.7% of the total. Martin, Brevard and Indian River Counties accounted for 22.0%, 15.0% and 2.1% of the total respectively. RECREATIONAL FISHERY: The recreational fishery for yellowtail snapper in Florida is far less valuable than the commercial catch. In 2003, for example, recreational anglers harvested only 22% of the total catch. Recreational anglers land yellowtail in all coastal areas in Florida, with most of the recreational harvest taken from waters in southwest Florida. Data from Florida Fish and Wildlife Research Institute (FWRI) show that fewer yellowtail are landed on the Atlantic coast than on the Gulf coast of Florida, though catch rates on the Gulf coat are highly variable. Current regulations for yellowtail in Florida and federal waters are a 10 fish bag-limit, with a minimum size of 12 inches total length. The information below reflects angler survey information taken from the 5-county area that encompasses the Indian River Lagoon. Approximately 687,052 yellowtail snapper were harvested in the waters of east central Florida from 1997 - 2001. The vast majority of the harvest was taken in nearshore waters to 3 miles (47.4%), and in offshore waters to 200 miles (45.3%). Inland waters other than the Indian River Lagoon accounted for 7.1% of the total IRL-area harvest, with the IRL itself accounting for only 0.2% of the recreational harvest.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogue of Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN/ISSN: 92-5-102321-2
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the western Atlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No. 59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (South Florida) - gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean.Agric.Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • Fischer, W., ed. 1978. FAO species identification sheets for fishery purposes. Western Central Atlantic, Vol. FAO, Rome.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.Johnson, A.G., 1983 Age and growth of yellowtail snapper from South Florida. Trans. Am. Fish. Soc. 112:173-177.
  • Jordan, D.S., and B.W. Evermann. 1898. The fishes of North and Middle America. Bull. U.S. Natl. Mus. 47. Part 2.
  • Lindeman, K.C., R. Pugliese, G.T. Waugh and J.S. Ault, 2000 Developmental patterns within a multispecies reef fishery: management applications for essential fish habitats and protected areas. Bull. Mar. Sci. 66(3):929-956.
  • Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology and fisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc., Boulder and London.
  • Manooch, C.S. III and C.L. Drennon, 1987 Age and growth of yellowtail snapper and queen triggerfish collected from the U.S. Virgin Islands and Puerto Rico. Fish. Res. 6:53-68.
  • Moe, M.A., Jr. 1972. Movement and migration of south Florida fishes. Fla. Dep. Nat. Resour. Tech. Ser. No. 69. l-25 pp.
  • Munro, J.L., V.C. Gaut, R. Thompson, and P.H. Reeson. 1973. The spawning seasons of Caribbean reef fishes. J. Fish Biol. 5:69-84.
  • Piedra, G., 1969 Materials on the biology of the yellow-tail snapper (Ocyurus chrysurus Bloch). p. 251-296. In: A.S. Bogdanov (ed.) Soviet-Cuban fishery research. Isr. Progr. Sci. Trans. Jerusalem, Israel.
  • Randall, J.E. 1967. Food habits of reef fishes of the West Indies. Stud. Trop. Oceanog. (Miami) 5:665-847.
  • Riley, C.M., G.J. Holt and C.R. Arnold, 1995 Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus. Fish. Bull. 93:179-185.
  • Rodriguez-Pino, Z. 1961. Lutjanus ambiguus. Cent. Invest. Pesq. Cuba14:1-20.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation and management of Caribbean reef fishes; scientific report of the O.D.S./U.W.I. fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecology and bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep. Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics of Caribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.) Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wallace, R.K., Jr. 1977. Thermal acclimation, upper temperature tolerance and preferred temperature of juvenile yellowtail snappers, Ocyurus chrysurus (Bloch) (Pisces: Lutjanidae). Bull. Mar. Sci. 27(2):292-298.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat. 6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellowtail snapper

Underwater photo of a yellowtail snapper (Ocyurus chrysurus)

The yellowtail snapper, Ocyurus chrysurus, is an abundant species of snapper found along the North American coast of the Atlantic Ocean. Although they have been found as far north as Massachusetts, their normal range is along Florida south to the West Indies and Brazil.

In certain reefs, most notably in the Florida Keys, this beautifully colored fish is commonly spotted among divers and snorkelers. The yellowtail snapper is also a popular and abundant game fish that makes excellent table fare. Yellowtails feed on shrimp, crabs, worms and smaller fish. They spawn in groups off the edges of reefs from spring to fall, but heavily in midsummer.

Yellowtail snapper are typically caught in 30-120 feet of water on and around reefs and other structure. The most common method of catching them is with hook and line, and the use of frozen chum to attract the fish. The chum is typically a five-pound block of leftover ground fish parts. The chum is placed into a mesh bag or metal basket in the water, and as the chum slowly melts, small pieces of fish will drift out and down towards the bottom, where the yellowtails typically feed. The chum attracts the fish, and keeps them near the boat for extended periods of time, as well.

Light tackle is the generally accepted means of catching yellowtail snapper. Typically, the fish are relatively wary of higher-test or thicker line, and larger hooks. Most fish caught by anglers range from eight inches to 14 inches, although catches to 16 inches are not uncommon. Catches larger than 17 inches are uncommon, and catches over 20 inches are considered rare. Yellowtail snapper can be caught on a variety of baits, including both live and frozen shrimp, squid, and a variety of live and frozen minnows or smaller baitfish. They can be caught on artificial baits and lures, but live or frozen bait is preferred. Yellowtail tend to be wary fish, and the appearance of larger predators, such as dolphins or sharks, can scare off schools until the offender leaves the area.

Most anglers pursue yellowtail snapper during the warmer months, but they can be caught throughout the year. Yellowtail must be a foot in overall length to be harvested in most areas, and bag limits apply in most regions. Yellowtail snapper is highly prized for its light, flaky meat and is considered by some to be one of the best of the snapper family.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!