Articles on this page are available in 2 other languages: Spanish (10), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits warm springs and their effluents, weedy ditches and canals (Ref. 5723). Found in various habitats, ranging from highly turbid water in ponds, canals and ditches at low elevations to pristine mountain streams at high elevations (Ref. 11225). Occurs in wide variety of habitats with low predation pressure, usually in very small streams and densely vegetated lakes and springs (Ref. 59043). Has a wide salinity range but requires fairly warm temperatures (23-24 °C) and quiet vegetated water for survival (Ref. 7248, 44894, 79840). Feeds on zooplankton, small insects and detritus. One of the most popular aquarium fishes with many standardized varieties. Used in genetics research. Female reaches 5 cm SL (Ref. 2847). Males mature at 2 months and females at 3 months of age (Ref. 1672). Aquarium keeping: in groups of 5 or more individuals; minimum aquarium size 60 cm (Ref. 51539). A very popular and widely available species in the aquarium trade. In Australia, wild populations were established prior to the 1970s, undoubtedly the result of thoughtless aquarists discarding unwanted pets (Ref. 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Absent

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Netherlands Antilles, and Venezuelan islands, Trinidad, and western Venezuela to Guyana. Present and likely introduced in Cuba, Hispaniola, Jamaica, St. Thomas, Dominica, Barbados, and Antigua (Burgess and Franz 1989). Introduced and established in Nevada, Arizona, New Mexico (Sublette et al. 1990), Idaho and Wyoming (Courtenay et al. 1987), Texas, Alberta, possibly California and Florida (Lee et al. 1980), and elsewhere; generally uncommon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South America: Venezuela, Barbados, Trinidad, northern Brazil and the Guyanas. Widely introduced and established elsewhere, mainly for mosquito control, but had rare to non-existing effects on mosquitoes, and negative to perhaps neutral effects on native fishes (Ref. 12217). Africa: Feral populations reported from the coastal reaches of Natal rivers from Durban southwards, as well as in the Kuruman Eye and Lake Otjikoto in Namibia (Ref. 7248). Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern South America and Western Atlantic; widely introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 7 - 8; Analspines: 0; Analsoft rays: 8 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 5 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 35 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

3.5 cm SL (male/unsexed; (Ref. 43281)); 6 cm SL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Found in shallow, warm, weedy, marginal habitats (Minckley 1973). In U.S., introduced populations have been found in warm springs and canal systems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; brackish; pH range: 7.0 - 8.0; dH range: 9 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.1 - 2

Graphical representation

Depth range (m): 0.1 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on insect larvae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in warm springs and their effluents, weedy ditches and canals (Ref. 5723). Found in various habitats, ranging from highly turbid water in ponds, canals and ditches at low elevations to pristine mountain streams at high elevations (Ref. 11225). Has a wide salinity range but requires fairly warm temperatures (23-24 °C) and quiet vegetated water for survival (Ref. 7248, 79840). Feeds on zooplankton, small insects and detritus. Feeds mainly on insects (Ref. 6154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Lebistes reticulatus preys on:
Culicomorpha

Based on studies in:
USA: Hawaii (Swamp)

This list may not be complete but is based on published studies.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (American Association for the Advancement of Science Publication 83, Washington, DC, 1967), pp. 420-431, from p. 424, from p. 424.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (AAAS Publication 83, Washington, DC, 1967), pp. 420-431, from p. 426.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Lebistes reticulatus is prey of:
Eleotris sandwicensis
Kuhlia sandvicensis

Based on studies in:
USA: Hawaii (Swamp)

This list may not be complete but is based on published studies.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (American Association for the Advancement of Science Publication 83, Washington, DC, 1967), pp. 420-431, from p. 424, from p. 424.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (AAAS Publication 83, Washington, DC, 1967), pp. 420-431, from p. 426.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Viral Diseases (general). Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tetrahymena Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skin Fungi (Saprolegnia sp.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nematode Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lernaea Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Lopez, N.C. 2001 Parasitic crustaceans in fishes from some Philippine lakes. p.75-79. In C.B. Santiago, M.L. Cuvin-Aralar and Z.U. Basiao (eds) Conservation and ecological management of Philippine lakes in relation to fisheries and aquaculture. SEAFDEC, Aquacult. Dept., Iloilo,Phil., PCAMRD, Los Baños, Lag., & BFAR Q.C. Phil.,187p. (Ref. 45120)   http://www.fishbase.org/references/FBRefSummary.php?id=45120&speccode=2 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish tuberculosis (FishMB). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eustrongylides Infestation 2 (Larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cryptobia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Congenital Deformities. Others
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Columnaris Disease (l.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Columnaris Disease (e.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camallanus Infection 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aontheca Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A natural mosquito-control agent. Populations reach very large numbers within native range. In Arizona, most stocks in Phoenix area die off in winter but are present the next year, probably due to subsequent releases (Minckley 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Males are about half the size of females with colorful tail and caudal fin; the anal fin is transformed into a gonopodium for internal fertilization. Males are continuously chasing and mating females. Females can store sperms for later fertilization and may produce young every four weeks. Pregnant females are recognizable by black triangle between anal and pelvic fins. After a gestation period of four to six weeks females give birth to 20-40 live young. No parental care is exercised and parents may even prey on their young.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

See summary of literature on reproduction by Breder and Rosen (1966. Modes of Reproduction in Fishes) (Lee et al. 1980). Extremely high fecundity. Ovoviparous.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Poecilia reticulata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Poecilia reticulata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCCTTCTGATCCGAGCCGAACTCAGCCAACCTGGGGCCCTCCTGGGGGATGATCAAATTTATAATGTAATCGTTACAGCTCATGCCTTTGTAATAATCTTTTTTATAGTCATACCAATCATAATCGGAGGCTTCGGTAATTGATTAGTCCCATTAATAATTGGCGCTCCTGACATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTTTTACCACCCTCATTTCTCCTCCTCCTATCATCCTCCGGGGTGGAAGCAGGAGCCGGTACAGGATGAACTGTTTATCCCCCTCTTGCAAGCAATTTAGCCCACGCTGGACCATCCGTGGATTTAACTATTTTTTCACTTCACCTGGCGGGTATTTCTTCCATTTTAGGAGCAATTAACTTCATCACCACTATTATTAACATAAAACCCCCTGCAGCATCTCAATATCAAACACCTTTATTTGTATGATCTGTAATAATCACAGCCGTTCTCCTGCTTCTCTCCCTCCCAGTTCTCGCTGCAGGTATTACAATACTTCTTACAGACCGGAATCTAAACACCACCTTCTTCGACCCTGCGGGAGGTGGTGACCCAATTCTTTACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Has been used for mosquito control. Used in carcinogenesis testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: This introduced species has had an adverse affect on the population of CRENICHTHYS BAILEYI at Preston Town Spring, White Pine County, Nevada (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Guppy

For other uses, see Guppy (disambiguation).

The guppy (Poecilia reticulata), also known as million fish and rainbow fish,[1] is one of the world's most widely distributed tropical fish, and one of the most popular freshwater aquarium fish species. It is a member of the Poeciliidae family and, like all other members of the family, is live-bearing.[2] Guppies, whose natural range is in northeast South America, were introduced to many habitats and are now found all over the world. They are highly adaptable and thrive in many different environmental and ecological conditions.[3] Male guppies, which are smaller than females, have ornamental caudal and dorsal fins, while females are duller in colour. Wild guppies generally feed on a variety of food source including benthic algae and aquatic insect larvae.[4] Guppies are used as a model organism in the field of ecology, evolution, and behavioural studies.[3]

Taxonomy[edit]

Guppies were first described in Venezuela as Poecilia reticulata by Wilhelm Peters in 1859 and as Lebistes poecilioides in Barbados by De Filippi in 1861. It was named Girardinus guppyi by Albert Günther in honor of Robert John Lechmere Guppy, who sent specimens of the species from Trinidad to the Natural History Museum in London. It was reclassified as Lebistes reticulatus by Regan in 1913. Then in 1963, Rosen and Bailey brought it back to its original name, Poecilia reticulata. While the taxonomy of the species was frequently changed and resulted in many synonyms, "guppy" remains the common name even as Girardinus guppii is now considered a junior synonym of Poecilia reticulata.[3]

Distribution and habitat[edit]

Guppies are native to Antigua and Barbuda, Barbados, Brazil, Guyana, Jamaica, the Netherlands Antilles, Trinidad and Tobago, the U.S. Virgin Islands and Venezuela.[5][6] However, guppies have been introduced to many different countries on every continent except Antarctica. Sometimes this has occurred accidentally, but most often as a means of mosquito control. It was expected that the guppies would eat the mosquito larvae and help slow the spread of malaria, but in many cases, these guppies have had a negative impact on native fish populations.[7] Field studies reveal that guppies have colonized almost every freshwater body accessible to them in their natural ranges, especially in the streams located near the coastal fringes of mainland South America. Although not typically found there, guppies also have tolerance to brackish water and have colonized some brackish habitats.[3] They tend to be more abundant in smaller streams and pools than in large, deep, or fast flowing rivers.[8]

Description[edit]

Sexual polymorphism exhibited in the Trinidadian guppy (above male, below female)
Guppy breeds

Guppies exhibit sexual dimorphism. While wild-type females are grey in body color, males have splashes, spots, or stripes that can be any of a wide variety of colors.[9] The size of guppies vary, but males are typically 1.5–3.5 centimetres (0.6–1.4 in) long, while females are 3–6 centimetres (1.2–2.4 in) long.

There are a variety of guppy strains produced by breeders through selective breeding, characterized by different colours, patterns, shapes, and sizes of fins, such as snakeskin and grass varieties. Many domestic strains have morphological traits that are very distinct from the wild-type antecedents. Males and females of many domestic strains usually have larger body size and are much more lavishly ornamented than their wild-type antecedents.[10]

Guppies have 23 pairs of chromosomes, including one pair of sex chromosomes, the same number as humans.[11] Genes that are responsible for male guppies' ornamentations are Y-chromosome linked and are heritable.[12]

Life cycle[edit]

There are around 2-3 generations of guppies per year in the wild. Guppies are well developed and capable of independent existence without further parental care by the time they are born. Young guppies school together and perform anti-predator tactics. Brood size is extremely variable, yet there are some consistent differences among populations depending on the predation level and other factors.[3] Females of matching body sizes tend to produce more numerous but smaller-sized offspring in high predation conditions. Female guppies first produce offspring at 10–20 weeks of age, and they continue to reproduce until 20–34 months of age. Male guppies mature in 7 weeks or less.[3] Total lifespan of guppies in the wild varies greatly, but it is typically around 2 years.[13] Variations in such life historic characteristics of guppies are observed in different populations, indicating that different evolutionary pressures exist.

Maturity[edit]

Guppies' body size is positively correlated with age, and their size at maturation varies highly depending on the predation risk of their habitats. Male and female guppies from high-predation regions mature faster and start reproducing earlier, and they devote more resources to reproduction than those from low-predation regions.[14] Females from high-predation regions reproduce more frequently and produce more offspring per litter, indicating that they are more fecund than low-predation females. Female guppies' reproductive success is also related to age. Older females produce offspring with reduced size and at increased interbrood intervals.[15]

Senescence[edit]

One major factor that affects wild guppies' senescence patterns is the mortality rate caused by predation. Guppies from high-predation environments suffer high extrinsic mortality rate because they are more likely to be killed by predators. Female guppies from high-predation habitats experience a significant increase in mortality at 6 months of age, while those from low-predation habitats do not suffer increased mortality until 16 months. However, guppies from high-predation environments were found to have longer lifespans because their reproductive lifespans are longer. There is no significant difference in post-reproductive lifespan.[13]

Population regulations[edit]

In addition to senescence pattern, resource availability and density also matters in regulation of guppy populations. Guppies reduce their fecundity and reproductive allocation in response to scarce food. When food is abundant, they increase brood size.[16] Differential reproductive allocation can be the cause of seasonality of life-history characteristics in some guppy populations. For example, during the wet season from May to December, guppies in the Northern Range of Trinidad reduce their investment in reproduction regardless of predation level, possibly in response to decreased food resources.[17] Population density also matters in simpler environments because higher intraspecific competition causes a decrease in reproductive rate and somatic growth rate, and a corresponding increase in juvenile mortality rate due to cannibalism.[18] It was confirmed that in low-predation habitats, guppy populations are in part regulated by density.[19]

Ecology and behavior[edit]

Mating[edit]

Wild male and female guppies

Guppies have the mating system called polyandry, where females promiscuously mate with multiple males.[20] Multiple mating is beneficial for males because the males' reproductive success is directly related to how many times they mate. The cost of multiple mating for males is very low because they do not provide material benefit to the females or parental care to the offspring. Conversely, multiple mating can be disadvantageous for females because it reduces foraging efficiency and increases the chances of predation and parasitic infection.[21] However, there are some potential benefits that females gain from multiple mating. For example, females that mate multiply are found to be able to produce more offspring in shorter gestation time, and their offspring tend to have better qualities such as enhanced schooling and predator evasion abilities.[21]

Female guppies re-mate more actively and delay the development of a brood when the anticipated second mate is more attractive than the first male. Experiments show that re-mating females prefer a novel male to the original male or a brother of the original male with similar phenotypes. Females' preference for novel males in re-mating can explain the excessive phenotypic polymorphism in male guppies.[22]

Females' mating choice[edit]

Female guppy choice plays an important role in multiple mating. Female guppies are attracted to brightly colored males, especially ones with orange spots on the flanks.[23] Orange spots can serve as an indicator of better physical fitness, as orange-spotted males are observed to swim longer in a strong current.[24] Due to the advantage in mating, male guppies evolve to have more ornamentation across generations in low-predation habitats where the cost of being conspicuous is lower. The rate and duration of courtship display of male guppies also play an important role in female guppies' mating choice. Courtship behavior is another indicator of fitness due to the physical strength involved in maintaining the courtship dance, called sigmoid display, in which the males flex their body into an S shape and vibrate rapidly.[25]

It is suggested that female mating choice may also be influenced by another female's choice. In an experiment, female guppies watched two males, one solitary and the other actively courting another female, and were given a choice between the two. Most females spent a longer time next to the male who was courting.[26] Female guppies' preference for fit males allows their descendants to inherit better physical fitness and better chance of survival.

Predation[edit]

Aequidens pulcher, a common predator of guppies

Guppies have many predators, such as larger fish and birds, in their natural habitats. Some of their common predators in the wild are Crenicichla alta, Rivulus hartii, and Aequidens pulcher.[27] Guppies' small bodies and the bright coloration of males make them easy prey, and like many fish, they often school together in order to avoid predation. Schooling is more favored by evolution in populations of guppies under high predation pressure, exerted either by predator type or predator density.[28] Coloration of guppies also evolves differentially in response to predation. Male guppies that are brighter in color have an advantage in mating as they attract more females in general, but they have a higher risk of being noticed by predators than duller males. Male guppies evolve to be more dull in color and have fewer, smaller spots under intense predation both in wild and in laboratory settings.[29] Female guppies in a high-predation environment also evolve to prefer brightly colored males less, often rejecting them.[30]

Predator inspection[edit]

When guppies encounter a potential predator, some of them will approach the predator to assess danger. This behavior, called predator inspection, benefits the inspector since it gains information, but puts the inspector at a risk of predation. In order to reduce the risk, inspectors avoid the predator's mouth area—called the 'attack cone'—and approach the predator from the side or back. They may also form a group for protection, the size of which is larger in high-predation populations. Although there is evidence that predators are less likely to attack an inspector than a non-inspector, the inspectors remain at higher risk due to proximity to the predator.[31]

Risk-taking behaviors such as predator inspection can be evolutionarily stable only when there is a mechanism that prevents selfish individuals from taking advantage of "altruistic" individuals. Researchers suggested that guppies adopt a conditional-approach strategy that resembles tit for tat. According to this hypothesis, guppies would inspect the predator on the first move, but if their co-inspectors do not participate in the predator inspection visits or do not approach the predator close enough, they can retaliate at the trailers by copying the trailer's last move in the next predator inspection visit. The hypothesis was supported in laboratory experiments.[32]

Feeding[edit]

Wild guppies feed on algal remains, diatoms, invertebrates, plant fragments, mineral particles, aquatic insect larvae, and other sources.Algal remains constitute the biggest proportion of wild guppy diet in most cases, but diets of wild guppies vary depending on the specific conditions of food availability in the habitat.[4][33] For example, a study on wild Trinidad guppies show that guppies collected from an oligotrophic upstream region (upper Aripo River) mainly consumed invertebrates while guppies from an eutrophic downstream region (lower Tacarigua River) consumed mostly diatoms and mineral particles. Algae are less nutritious than invertebrates, and the guppies that feed mainly on algae have poor diets.[3]

Guppies' diet preference is not simply correlated to the abundance of a particular food. Laboratory experiments confirmed that guppies show 'diet switching' behavior, in which they feed disproportionately on the more abundant food when they are offered two food choices. The result shows that different groups of guppies have weak and variable food preference.[34] Diet preference in guppies could be related to factors such as the presence of competitors. For example, the lower Tacarigua River has a larger variety of species and competition for invertebrate prey is higher, therefore the proportion of invertebrates is small in diets of those guppies.[3]

Foraging[edit]

Guppies often forage in groups because they can find food more easily. Shoaling guppies spend less time and energy on anti-predatory behavior than solitary ones and spend more time on feeding. However, such behavior results in food that is found being shared with other members of the group. Studies also show that there is an evolutionary cost, where guppies that tend to shoal are less aggressive and less competitive with regards to scarce resources.[35] Therefore, it is suggested that shoaling is preferred in high-predation regions but not in low-predation regions. In an experiment, guppies with a high tendency to shoal were isolated from high-predation regions and were relocated to predator-free environments. Over time, they decreased their shoaling behavior, supporting the hypothesis that shoaling is less preferred in low-predation environment.[36]

Reproduction[edit]

Birth of guppy fry
A guppy fry in an aquarium at one week old

Guppies are highly prolific livebearers.[37] The gestation period of a guppy is typically 21–30 days, varying considerably. Reproduction typically continues through the year, and the female becomes ready for conception again quickly after parturition.[3] Male guppies, like other members of the Poeciliidae family, possess a modified tubular anal fin called the gonopodium, located directly behind the ventral fin. The gonopodium has a channel-like structure through which bundles of spermatozoa, called spermatozeugmata, are transferred to females. In courted mating, where the female shows receptive behavior following the male's courtship display, the male briefly inserts the gonopodium into the female's genital pore for internal fertilization. On the other hand, in the case of sneaky mating where copulation is forced, the male approaches the female and thrusts the gonopodium at the female's urogenital pore.[38]

Once inseminated, female guppies can store sperm in their ovaries and gonoducts, which can continue to fertilize ova up to eight months.[39] Because of the sperm-storage mechanism, males are capable of posthumous reproduction, meaning that the female mate can give birth to the male's offspring long after the male's death, which contributes significantly to the reproductive dynamics of the wild guppy populations.[40]

The guppy has been successfully hybridised with various species of molly (Poecilia latipinna or velifera), e.g., male guppy and female molly. However, the hybrids are always male and appear to be infertile.[41] The guppy has also been hybridised with the Endler's livebearer (Poecilia wingei) to produce fertile offspring, with the suggestion that, despite physical and behavioural differences, Endler's may represent a subspecies of Poecilia reticulata rather than a distinct species.[42][43]

In the aquarium[edit]

Guppy standards

Guppies prefer a hard water aquarium with a temperature between 25.5 and 27.8 °C (78 and 82 °F) and salt levels equivalent to one tablespoon per 19 litres (5 US gal).[44] They can withstand levels of salinity up to 150% that of normal seawater,[45] which has led to them being occasionally included in marine tropical community tanks, as well as in freshwater tropical tanks. Guppies are generally peaceful, though nipping behaviour is sometimes exhibited between male guppies or towards other top swimmers like members of the Xiphophorus family (platies and swordtails), and occasionally other fish with prominent fins, such as angelfish. Guppys should not be kept as a single fish in an aquarium because both males and females show signs of shoaling, and are usually found in large groups in the wild. Its most famous characteristic is its propensity for breeding, and it can breed in both fresh water and marine aquariums.[46]

Guppies prefer water temperatures of about 22.2 to 26.1 °C (72 to 79 °F) for reproduction. Pregnant female guppies have enlarged and darkened gravid spots near the anal vent. Just before birth, the eyes of fry may be seen through the translucent skin in this area of the female's body.[47] When birth occurs, individual offspring are dropped in sequence, typically over a period of one to six hours. The female guppy has drops of between 2 and 200 fry at a time, typically ranging between 30 and 60.[48]

Well-fed adults do not often eat their own young, although sometimes safe zones are required for the fry. Specially designed livebearer birthing tanks, which can be suspended inside the aquarium, are available from aquatic retailers. These also serve to shield the pregnant female from further attention from the males, which is important because the males will sometimes attack the females while they are giving birth.[49] It also provides a separate area for the newborn young as protection from being eaten by their mother.[50] However, if a female is put in the breeder box too early, it may cause her to have a miscarriage. Well-planted tanks that offer a lot of barriers to adult guppies will shelter the young quite well. Guppy grass, water sprite, water wisteria, duckweed, and java moss are all good choices. A continuous supply of live food, such as Daphnia or brine shrimp, will keep adult fish full and may spare the fry when they are born.[51] Young fry take roughly three or four months to reach maturity. It is recommended to feed fry live foods, such as baby brine shrimp, microworms, infusoria and vinegar eels. Alternatives include finely ground flake food, egg yolk and liquid fish food, though the particulates in these may be too large for the youngest fry to eat.[52]

References[edit]

  1. ^ "Common Names of Poecilia reticulata". FishBase.org. Retrieved 16 November 2013. 
  2. ^ "Guppy Fish". AquaticCommunity.com. Archived from the original on 9 June 2012. Retrieved 24 February 2013. 
  3. ^ a b c d e f g h i Magurran, Anne E. (2005). Evolutionary Ecology: The Trinidadian Guppy. New York: Oxford University Press. ISBN 978-0-19-852786-2. 
  4. ^ a b Dussault, Gertrude V.; Kramer, Donald L. (1981). "Food and feeding behavior of the guppy, Poecilia reticulata (Pisces: Poeciliidae)". Canadian Journal of Zoology 59 (4): 684–701. doi:10.1139/z81-098. 
  5. ^ "Countries where Poecilia reticulata is found". FishBase.org. Archived from the original on 21 September 2013. Retrieved 24 February 2010. 
  6. ^ "Poecilia reticulata (fish)". Global Invasive Species Database. 27 October 2006. Archived from the original on 21 September 2013. Retrieved 27 August 2010. 
  7. ^ Froese, Rainer and Pauly, Daniel, eds. (2007). "Poecilia reticulata" in FishBase. April 2007 version.
  8. ^ Magurran, Anne E.; Phillip, Dawn A. T. (2001). "Evolutionary implications of large-scale patterns in the ecology of Trinidadian guppies, Poecilia reticulata". Biological Journal of the Linnean Society 73: 1–9. doi:10.1006/bijl.2000.0519. 
  9. ^ "Poecilia reticulata: Guppy". SeriouslyFish.com. Archived from the original on 19 October 2013. Retrieved 24 February 2013. 
  10. ^ "Poecilia reticulata Peters, 1860". Viviparos.com. Archived from the original on 19 January 2012. Retrieved 18 November 2013. 
  11. ^ Khoo, Gideon; Lim, Tit Meng; Chan, Woon-Khiong; Phang, Violet P. E. (1999). "Genetic Basis of the Variegated Tail Pattern in the Guppy, Poecilia reticulata". Zoological Science 16 (3): 431–437. doi:10.2108/zsj.16.431. 
  12. ^ Brooks, Robert (2000). "Negative genetic correlation between male sexual attractiveness and survival". Nature 406: 67–70. doi:10.1038/35017552. 
  13. ^ a b Reznick, David N.; Bryant, Michael; Holmes, Donna (2006). "The Evolution of Senescence and Post-Reproductive Lifespan in Guppies (Poecilia reticulata)". PLOS Biology 4 (1): 136–143. doi:10.1371/journal.pbio.0040007. PMC 1318473. PMID 16363919. 
  14. ^ Reznick, David N.; Butler, Mark J., IV; Rodd, F. Helen; Ross, Patrick (1996). "Life-History Evolution in Guppies (Poecilia reticulata) 6. Differential Mortality as a Mechanism for Natural Selection". Evolution 50 (4): 1651–1660. JSTOR 2410901. 
  15. ^ Reznick, David N.; Buckwalter, G.; Groff, J.; Elder, D. (2001). "The evolution of senescence in natural populations of guppies (Poecilia reticulata): a comparative approach". Experimental Gerontology 36 (4-6): 791–812. doi:10.1016/S0531-5565(00)00241-2. PMID 11295514. 
  16. ^ Reznick, David N. (1983). "The Structure of Guppy Life Histories: The Tradeoff between Growth and Reproduction". Ecology 64 (4): 862–873. doi:10.2307/1937209. 
  17. ^ Reznick, David N. (1989). "Life-History Evolution in Guppies: 2. Repeatability of Field Observations and the Effects of Season on Life Histories". Evolution 43 (6): 1285–1297. JSTOR 2409363. 
  18. ^ Barlow, Jay (1992). "Nonlinear and Logistic Growth In Experimental Populations of Guppies". Ecology 73 (3): 941–950. doi:10.2307/1940170. 
  19. ^ Bronikowski, Anne M.; Clark, Mark E.; Rodd, F. Helen; Reznick, David N. (2002). "Population-Dynamic Consequences of Predator-Induced Life History Variation in the Guppy (Poecilia reticulata)". Ecology 83 (8): 2194–2204. JSTOR 3072051. 
  20. ^ Barbosa, Miguel; Magurran, Anne E. (2011). "Evidence of female-promoted polyandry in Trinidadian guppies". Environmental Biology of Fishes 90 (1): 95–102. doi:10.1007/s10641-010-9721-y. 
  21. ^ a b Evans, J. P.; Magurran, Anne E. (2000). "Multiple benefits of multiple mating in guppies". Proceedings of the National Academy of Sciences of the United States of America 97 (18): 10074–10076. doi:10.1073/pnas.180207297. PMC 27698. PMID 10954750. 
  22. ^ Eakley, Angela L.; Houde, Anne E. (2004). "Possible role of female discrimination against 'redundant' males in the evolution of colour pattern polymorphism in guppies". Proceedings of the Royal Society B 271 (Suppl 5): S299–S301. doi:10.1098/rsbl.2004.0165. PMC 1810072. PMID 15504000. 
  23. ^ Houde, Anne E. (April 1988). "Genetic difference in female choice between two guppy populations". Animal Behaviour 36 (2): 511–516. doi:10.1016/S0003-3472(88)80022-8. 
  24. ^ Nicoletto, Paul F. (June 1991). "The relationship between male ornamentation and swimming performance in the guppy, Poecilia reticulata". Behavioral Ecology and Sociobiology 28 (5): 365–370. doi:10.1007/BF00164386. 
  25. ^ Nicoletto, Paul F. (1996). "The influence of water velocity on the display behavior of male guppies, Poecilia reticulata". Behavioral Ecology 7 (3): 272–278. doi:10.1093/beheco/7.3.272. 
  26. ^ Dugatkin, L. A. (1992). "Sexual selection and imitation: Females copy the mate choice of others". The American Naturalist 139 (6): 1384–1389. doi:10.2307/2462347. 
  27. ^ "Sex and the single guppy". PBS. Archived from the original on 12 December 2013. Retrieved 6 December 2013. 
  28. ^ Seghers, Benoni H. (September 1974). "Schooling Behavior in the Guppy (Poecilia reticulata): An Evolutionary Response to Predation". Evolution 28 (3): 486–489. JSTOR 2407174. 
  29. ^ Endler, John A. (January 1980). "Natural Selection on Color Patterns in Poecilia reticulata". Evolution 34 (1): 76–91. JSTOR 2408316. 
  30. ^ Stoner, Gregory; Breden, Felix (April 1988). "Phenotypic differentiation in female preference related to geographic variation in male predation risk in the Trinidad guppy (Poecilia reticulata)". Behavioral Ecology and Sociobiology 22 (4): 285–291. doi:10.1007/BF00299844. 
  31. ^ Magurran, Anne E.; Seghers, Benoni H. (September 1990). "Population differences in predator recognition and attack cone avoidance in the guppy Poecilia reticulata". Animal Behaviour 40 (3): 443–452. doi:10.1016/S0003-3472(05)80524-X. 
  32. ^ Dugatkin, Lee A.; Alfieri, Michael (July 1991). "Tit-For-Tat in guppies (Poecilia reticulata): the relative nature of cooperation and defection during predator inspection". Evolutionary Ecology 5 (3): 300–309. doi:10.1007/BF02214234. 
  33. ^ Lawal, M. O.; Edokpayi, C. A.; Osibona, A. O. (2012). "Food and Feeding Habits of the Guppy, Poecilia reticulata, from Drainage Canal Systems in Lagos, Southwestern Nigeria". West African Journal of Applied Ecology 20 (2): 1–9. Archived from the original on 3 December 2013. 
  34. ^ Murduch, William W.; Avery, S.; Smyth, Michael E. B. (1975). "Switching in Predatory Fish". Ecology 56 (5): 1094–1105. doi:10.2307/1936149. 
  35. ^ Magurran, Anne E.; Seghers, Benoni H. (1991). "Variation in schooling and aggression amongst guppy (Poecilia reticulata) populations in Trinidad". Behaviour 118 (3/4): 214–234. doi:10.1163/156853991X00292. JSTOR 4534965. 
  36. ^ Magurran, Anne E.; Seghers, Benoni H.; Carvalho, Gary R.; Shaw, Paul W. (1992). "Behavioural Consequences of an Artificial Introduction of Guppies (Poecilia reticulata) in N. Trinidad: Evidence for the Evolution of Anti-Predator Behaviour in the Wild". Proceedings of the Royal Society B 248 (1322): 117–122. doi:10.1098/rspb.1992.0050. 
  37. ^ "Guppy". Encyclopædia Britannica Online. 2007. Archived from the original on 13 May 2008. Retrieved 7 May 2007. 
  38. ^ Reynolds, John D.; Gross, Mart R.; Coombs, Mark J. (1993). "Environmental conditions and male morphology determine alternative mating behavior in Trinidadian guppies". Animal Behaviour 45 (1): 145–152. doi:10.1006/anbe.1993.1013. 
  39. ^ Winge, Ö. (1937). "Succession of broods in Lebistes". Nature 140: 467. doi:10.1038/140467b0. 
  40. ^ "Beyond lifetime reproductive success: the posthumous reproductive dynamics of male Trinidadian guppies". Proceedings of the Royal Society B 280 (1763). 2013. doi:10.1098/rspb.2013.1116. 
  41. ^ Ghadially, F. N.; Gordon, M. (July 1957). "A Localized Melanoma in a Hybrid Fish Lebistes × Mollienesia". Cancer Research 17 (6): 597–599. PMID 13446844. 
  42. ^ Griffitts, Tony (1997). "Endler's Livebearer". Aquaworld Aquarium. Archived from the original on 2 December 2013. Retrieved 26 November 2013. 
  43. ^ Griffitts, Tony (2011). "Endler's Livebearer: It's a Guppy!". Aquaworld Aquarium. Archived from the original on 24 July 2013. Retrieved 26 November 2013. 
  44. ^ Hargrove, Maddy; Hargrove, Mic (2006). Freshwater Aquariums for Dummies (2nd ed.). Hoboken: Wiley. p. 99. ISBN 978-0-470-05103-0. 
  45. ^ Chervinski, J. (April 1984). "Salinity tolerance of the guppy, Poecilia Reticulata Peters". Journal of Fish Biology 24 (4): 449–452. doi:10.1111/j.1095-8649.1984.tb04815.x. 
  46. ^ Shikano, Takahito; Fujio, Yoshihisa (August 1997). "Successful Propagation in Seawater of the Guppy Poecilia reticulata with Reference to High Salinity Tolerance at Birth". Fisheries Science 63 (4): 573–575. 
  47. ^ Mayntz, Melissa. "Gestation Period for Guppies". LoveToKnow.com. Archived from the original on 3 December 2013. Retrieved 25 November 2013. 
  48. ^ Donovan, Dave. "Pregnant Guppy Fish". LoveToKnow.com. Archived from the original on 2 December 2013. Retrieved 25 November 2013. 
  49. ^ "Breed Guppies – Tips You Need to Know". Guppybreeding.net. 20 April 2012. Archived from the original on 24 December 2013. Retrieved 6 December 2013. 
  50. ^ "Guppy fry care: how to look after baby guppies". Guppyfishcare.com. 12 October 2013. Archived from the original on 22 October 2013. Retrieved 6 December 2013. 
  51. ^ "Livebearers: Guppies". TropicalFauna.info. Archived from the original on 7 December 2013. 
  52. ^ Carroll, Fussell. "Tiny Foods For Small Fry". FishChannel.com. Archived from the original on 2 December 2013. Retrieved 26 November 2013. 

Further reading[edit]

  • Houde, Anne E (1997). Sex, Color, and Mate Choice in Guppies. Princeton, NJ: Princeton University Press. p. 227. ISBN 978-0-691-02789-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Included in order Cyprinodontiformes by Parenti (1981); formerly in order Atheriniformes.

See Breden et al. (1999) for a molecular phylogeny of POECILIA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!