Overview

Comprehensive Description

Bathyraja abyssicola (Gilbert, 1896)

Description: The egg cases of Bathyraja abyssicola (Figure 2) are large, 108 to 111 mm in length, with MAW about 67-69% of ECL. Egg case surface texture coarse and very rough to the touch, striated, the surface is irregular and with rasp-like denticles. LKW is very narrow, <5% of MAW and with a distinct groove between the lateral keel and case proper. This groove is not present in any other ENP skate egg case. Lateral keels extend onto horns and are also present on inner horns. Anterior apron border of egg case broad and concave, anterior horns more robust than posteriors at base, becoming flattened and thread-like at tips. Posterior apron is nearly straight, broad, and transverse, about 10 mm wider than anterior apron. Posterior horns long, about two times length of anteriors and about 1.2 times ECL, curved inwards, each tapering to a thread-like tip. Attachment fibers present, originating on lateral keel near the junction of exterior base of posterior horns and case. Egg cases removed from a single specimen was a light golden brown in color.

Remarks: Bathyraja abyssicola is a large, deepwater species usually found on the continental slope between 362 and 2906 m, although most records of its capture have come from> 1,000 m deep (Zorzi & Anderson, 1988). It is considered to be a rare species, but recent deepwater surveys along the ENP continental slope have revealed this skate to be more common than previously thought (unpublished data). To the best of our knowledge this is the first confirmed record and description of the egg case of this species.

Material examined: CAS 224336, 141.0 cm TL, west of Alexander Island, Washington ( 47.4935 N , - 125.5185 W ), 1428 m, 24 August 2004 .

  • David A. Ebert, Chante D. Davis (2007): Descriptions of skate egg cases (Chondrichthyes: Rajiformes: Rajoidei) from the eastern North Pacific. Zootaxa 1393, 1-18: 3-4, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:0C16005C-21BC-4252-823E-C83515FCFF28
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsule measures 105.8 mm long and 65.2 mm wide (Ref. 41249).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Its range is continuous in the northern Pacific from Bishop Rock, West Cortes Basin, California through the Bering Sea and Sea of Okhotsk to Choshi on the Pacific central coast of Honshu, Japan (Dolganov 1983; Nakaya 1983; Ishihara and Ishiyama 1985, 1986; Zorzi and Anderson 1988, 1990; Zorzi and Martin, unpubl. data). Until the past few years there were fewer than a dozen known specimens of this skate in collections, attesting to the infrequency with which it was taken in deep-set research collecting gear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Pacific coast of Japan and from British Columbia, Canada to Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1370 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

137 cm TL (male/unsexed; (Ref. 6885))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Bathyraja abyssicola
Catalog Number: USNM 48623
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1890
Locality: Queen Charlotte Is. Brit. Col. 1,588 Fms., British Columbia, Canada, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The rare deepsea skate was and remains the deepest occurring known rajid species, being recorded from depths of 396?2,904 m (Grinols 1965; Miller and Lea 1972; Eschmeyer et al. 1983; Zorzi and Anderson 1988, 1990). Due to the depths it inhabits and paucity of collection of this species little is known about its biology. Like all skates it is oviparous, but the number of eggs produced per reproductive cycle and the length of embryonic development are unknown. Size at maturity is estimated by Zorzi and Anderson (1988) as 1.1 m for males, although no specimens in the 0.75?1.0 m range occurred in the sample they examined so no closer estimate of minimum mature size could be made. Information on stomach contents and food habits of B. abyssicola are generally lacking. Some of the 145 specimens observed by Cook (1979) from 1,000?1,200 m depth curves of the continental slope south-west of the Pribilofs, central Bering Sea, were examined and found to hold remains of molluscs (sea snails) and lesser amounts of bony fishes (grenadiers, snailfishes, eelpouts and flatnoses (codlings)).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 362 - 2910 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 550 - 2614.17
  Temperature range (°C): 1.763 - 4.911
  Nitrate (umol/L): 40.321 - 44.846
  Salinity (PPS): 34.198 - 34.641
  Oxygen (ml/l): 0.466 - 2.352
  Phosphate (umol/l): 2.929 - 3.284
  Silicate (umol/l): 102.211 - 181.171

Graphical representation

Depth range (m): 550 - 2614.17

Temperature range (°C): 1.763 - 4.911

Nitrate (umol/L): 40.321 - 44.846

Salinity (PPS): 34.198 - 34.641

Oxygen (ml/l): 0.466 - 2.352

Phosphate (umol/l): 2.929 - 3.284

Silicate (umol/l): 102.211 - 181.171
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 2910m.
Recorded at 2910 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathyraja abyssicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTGATCTTTGGTGCCTGAGCAGGGATGGTCGGGACTGGTCTTAGTCTTCTGATCCGAGCTGAATTAAGTCAACCTGGAACCCTTTTAGGTGATGATCAGATTTATAATGTTATTGTTACAGCCCATGCCTTTGTAATAATCTTCTTTATGGTTATGCCCATCATAATCGGAGGTTTCGGTAATTGGCTTGTCCCTTTAATGATTGGTTCTCCAGACATAGCTTTTCCACGCATAAATAATATAAGCTTCTGACTTCTACCTCCATCTTTTCTTCTGCTTCTAGCCTCTGCCGGTGTTGAAGCTGGAGCAGGGACTGGCTGAACTGTTTATCCCCCACTAGCAGGGAATCTTGCCCATGCAGGAGCTTCCGTTGATTTAACAATTTTCTCTCTTCACTTAGCCGGAATCTCATCTATCTTAGCATCAATTAATTTTATTACTACTATTATTAATATAAAACCACCAGCAATTTCACAATACCAAACACCTTTATTTGTATGATCAGTTCTTGTCACAACTGTACTACTTCTTTTAGCTCTCCCAGTTTTAGCAGCAGCTATCACTATACTTTTAACAGATCGTAATCTTAACACAACTTTCTTCGACCCAGCAGGGGGAGGGGATCCTATTTTATATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathyraja abyssicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Cook, S. & Zorzi, G.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

Information is lacking on the range, population size and general and reproductive biology of this (and indeed other) rarely recorded deep-sea species, hence it is assessed as Data Deficient. However, as fisheries for other traditional species move deeper, the Deepsea Skate (Bathyraja abyssicola) will become subject to increased incidental capture. More research is required on this and other poorly known deep-sea species to fully determine their threatened status.
History
  • 2000
    Data Deficient
  • 1996
    Data Deficient

Geographic Range


Range Description
Its range is continuous in the northern Pacific from Bishop Rock, West Cortes Basin, California through the Bering Sea and Sea of Okhotsk to Choshi on the Pacific central coast of Honshu, Japan (Dolganov 1983; Nakaya 1983; Ishihara and Ishiyama 1985, 1986; Zorzi and Anderson 1988, 1990; Zorzi and Martin, unpubl. data). Until the past few years there were fewer than a dozen known specimens of this skate in collections, attesting to the infrequency with which it was taken in deep-set research collecting gear.

Countries
  • Native
    • Japan
    • Russian Federation
    • United States

FAO Marine Fishing Areas
  • Native
    • Pacific – northwest
    • Pacific – northeast

Population


Population
A rare, deepsea skate.

Population Trend
Unknown

Habitat and Ecology


Habitat and Ecology
The rare deepsea skate was and remains the deepest occurring known rajid species, being recorded from depths of 396?2,904 m (Grinols 1965; Miller and Lea 1972; Eschmeyer et al. 1983; Zorzi and Anderson 1988, 1990). Due to the depths it inhabits and paucity of collection of this species little is known about its biology. Like all skates it is oviparous, but the number of eggs produced per reproductive cycle and the length of embryonic development are unknown. Size at maturity is estimated by Zorzi and Anderson (1988) as 1.1 m for males, although no specimens in the 0.75?1.0 m range occurred in the sample they examined so no closer estimate of minimum mature size could be made. Information on stomach contents and food habits of B. abyssicola are generally lacking. Some of the 145 specimens observed by Cook (1979) from 1,000?1,200 m depth curves of the continental slope south-west of the Pribilofs, central Bering Sea, were examined and found to hold remains of molluscs (sea snails) and lesser amounts of bony fishes (grenadiers, snailfishes, eelpouts and flatnoses (codlings)).

Systems
  • Marine

Threats


Major Threats
Due to the rarity of this species and the depths at which it occurs, it is only taken in extreme deep-set gear (>400 m depth). It has been taken in bottom (otter) trawls. It is not common enough to be sought commercially, but it is apparently regularly taken by deep commercial trawling gear set for flatfishes in the Bering Sea. As commercial fisheries operations in other portions of its range move to trawl deeper waters (i.e., Oregon, where trawling for Thornyheads (Sebastolobus spp.) is currently being conducted down to the 1,300 m isobath (J. Griffith pers. comm.)), we can expect to see many more of this species taken incidentally. Due to the number of this species observed by Cook (1979) in Japanese deep trawls in the Bering Sea, it may be more commonly harvested than once believed. Due to its apparent rarity, it may be heavily impacted by increasing bathybenthic commercial fishery efforts. One record exists of this species being taken in a commercial blackcod (sablefish) trap (Zorzi pers. comm.).

Conservation Actions


Conservation Actions
None in place for this species. More research is required on this and other poorly known deep-sea species to fully determine their threatened status (Raschi et al. 1994).

Citation

Cook, S. & Zorzi, G. 2009. Bathyraja abyssicola. In: IUCN 2013 . IUCN Red List of Threatened Species. Version 2013.1 . <www.iucnredlist.org>. Downloaded on 10 February 2014 .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A rare, deepsea skate.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Due to the rarity of this species and the depths at which it occurs, it is only taken in extreme deep-set gear (>400 m depth). It has been taken in bottom (otter) trawls. It is not common enough to be sought commercially, but it is apparently regularly taken by deep commercial trawling gear set for flatfishes in the Bering Sea. As commercial fisheries operations in other portions of its range move to trawl deeper waters (i.e., Oregon, where trawling for Thornyheads (Sebastolobus spp.) is currently being conducted down to the 1,300 m isobath (J. Griffith pers. comm.)), we can expect to see many more of this species taken incidentally. Due to the number of this species observed by Cook (1979) in Japanese deep trawls in the Bering Sea, it may be more commonly harvested than once believed. Due to its apparent rarity, it may be heavily impacted by increasing bathybenthic commercial fishery efforts. One record exists of this species being taken in a commercial blackcod (sablefish) trap (Zorzi pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in place for this species. More research is required on this and other poorly known deep-sea species to fully determine their threatened status (Raschi et al. 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Deepsea skate

The deepsea skate, Bathyraja abyssicola, is a species of softnose skate, family Rajidae, found in deep water from 362 to 2,906 m, usually on the continental slope. They are distributed from off northern Baja California around Coronado Island and Cortes Bank, north to the Bering Sea, and west to Japan. It is fairly common below 1,000 m, and is taken as by-catch in deepwater trawls and traps. The species name abyssicola comes from the Greek abyssos meaning "bottomless", and cola meaning "living at depths".[2]

The pectoral fin disc of the deepsea skate has a moderately triangular anterior margin, a broadly rounded posterior margin, and rounded tips. The disc is slightly wider than it is long. There are 1-5 nuchal thorns (placed on the dorsal midline behind the eyes), separated from a continuous row of 21-32 median tail thorns. The tail is moderately long, narrow, and tapering, terminating in a small, low-set caudal fin. There are two close-set dorsal fins, usually with an interdorsal thorn. Its coloration is grayish purple to dark chocolate brown or black above, occasionally with scattered small darker spots, and slightly darker below except for a whitish area around the mouth. The anterior tip of the pelvic fins are whitish. Large males have irregular whitish blotches and numerous dark spots while females have reduced or absent blotches. Juveniles tend to be uniform in color.[2]

The deepsea skate is oviparous. The egg cases are oblong capsules with stiff pointed horns at the corners, deposited on sandy or muddy flats. One egg case measured 105.8 mm long and 65.2 mm wide. The young may tend to follow large objects, such as their mother.[3] Males mature at 110-120 cm and grow at least as large as 135 cm, while females attain at least 157 cm. The smallest known free-swimming specimens measured 34-36 cm. Deepwater skates feed on benthic organisms, including annelid worms, cephalopods, tanner crabs, shrimps, and bony fishes. Invertebrates comprise a greater proportion of the diet than fishes in juveniles below 1 m.[2]

References[edit]

  1. ^ Cook, S. and Zorzi, G. (2000). Bathyraja abyssicola. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 14 November 2008.
  2. ^ a b c Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. London: University of California Press. ISBN 0-520-23484-7. 
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Bathyraja abyssicola" in FishBase. November 2008 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!