Overview

Comprehensive Description

Biology

Found over sandy areas of lagoon and seaward reefs (Ref. 9710). Often in schools (Ref. 26938). Forms schools with the smallmouth grunt (Haemulon chrysargyreum), an association regarded as social protective mimicry (Ref. 52492). Juveniles are common in seagrass beds (Ref. 9710). Feeds on benthic invertebrates (Ref. 7313). Marketed fresh (Ref. 3792).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda and Florida, USA to Brazil, including the Gulf of Mexico and the Caribbean Sea (Ref. 9626). Eastern Atlantic: single record from Ile de Sào Tiago, Baie de Tarrafal, Cape Verde (Ref. 7313). Reported from São Tomé Island (Ref. 34088).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western and eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 8; Analspines: 2; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 394 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

39.4 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body pale tan with distinctive yellow stripe from eye to caudal fin; tail yellow. Less brightly colored than other species and is the only one with a single yellow stripe along side (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 49 m (Ref. 9710), usually 0 - 35 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0.75 - 88
  Temperature range (°C): 22.893 - 28.503
  Nitrate (umol/L): 0.253 - 2.663
  Salinity (PPS): 34.880 - 36.788
  Oxygen (ml/l): 3.708 - 4.686
  Phosphate (umol/l): 0.075 - 0.293
  Silicate (umol/l): 1.328 - 5.012

Graphical representation

Depth range (m): 0.75 - 88

Temperature range (°C): 22.893 - 28.503

Nitrate (umol/L): 0.253 - 2.663

Salinity (PPS): 34.880 - 36.788

Oxygen (ml/l): 3.708 - 4.686

Phosphate (umol/l): 0.075 - 0.293

Silicate (umol/l): 1.328 - 5.012
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 49m.
Recorded at 49 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found over sandy areas of lagoon and seaward reefs (Ref. 9710). Juveniles are common in seagrass beds (Ref. 9710). Often in schools (Ref. 26938). Forms schools with the smallmouth grunt (Haemulon chrysargyreum), an association regarded as social protective mimicry (Ref. 52492). Feeds on benthic invertebrates (Ref. 7313). Feeds mostly on benthic organisms (Ref. 33, 26338). Microinvertivore (Ref. 33499, 057616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mulloidichthys martinicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTCTTTGGTGCCTGAGCCGGAATGGTAGGAACGGCTTTAAGCCTTCTTATTCGTGCCGAGCTTAGTCAACCCGGCGCTCTCCTAGGCGACGATCAGATCTACAACGTAATTGTTACAGCACACGCCTTTGTAATAATTTTCTTTATGGTCATGCCAATCATGATTGGCGGGTTCGGTAACTGACTGATCCCTCTTATGATTGGAGCCCCAGATATGGCCTTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCTTCTTTCCTACTCCTACTCGCCTCTTCAGGTGTTGAAGCCGGGGCTGGAACTGGATGAACCGTTTATCCCCCTCTAGCAGGCAATCTGGCCCACGCCGGAGCCTCAGTAGACCTAACCATCTTCTCCCTCCACCTAGCGGGGATCTCTTCTATTCTAGGGGCCATTAATTTTATTACCACAATTATTAATATGAAACCCCCAGCAATTTCGCAGTACCAGACACCTCTATTTGTCTGAGCCGTCCTAATTACAGCTGTCCTTCTTCTTCTGTCGCTCCCTGTCCTTGCTGCCGGCATCACAATGCTACTCACAGACCGAAACTTAAATACAACCTTCTTCGACCCAGCAGGCGGAGGTGACCCAATCCTTTACCAACACCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mulloidichthys martinicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow goatfish

The yellow goatfish (Mulloidichthys martinicus), also known as yellowsaddle, is a species of goatfish native to the Atlantic Ocean around the coasts of Africa and the Americas. This species can reach a length of 39.4 centimetres (15.5 in) TL, but most reach lengths only around 28 centimetres (11 in). They are of minor importance to local commercial fisheries, even though they have been reported to carry the ciguatera toxin.[1]

Habits[edit]

Yellow goatfish are benthic feeders, using a pair of long chemosensory barbels ("whiskers") protruding from their chins to rifle through the sediments in search of a meal. They usually feed on smaller fish, hunting in a school during the day, and alone at night.[2]

Distribution[edit]

The yellow goatfish can be found on reefs in the tropical waters in the Atlantic around the United States, in the Gulf of Mexico, the Caribbean Sea, and around Cape Verde.[1]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Mulloidichthys martinicus" in FishBase. December 2013 version.
  2. ^ "The Marine Center: Yellow Goatfish". The Marine Center. 1994–2009. Retrieved 25 November 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!