Overview

Comprehensive Description

Biology

Occur in bays and estuaries, but more commonly in deep offshore waters (Ref. 9563). Inhabit sandy substrates. Juveniles feed mainly on crustaceans such as copepods and mysidaceans, whereas larger fishes (11-20 cm) consume more polychaetes (Ref. 6223). Sexually mature below 13 cm SL and rarely exceeds 17 cm in Western Australia. Oviparous (Ref. 205), multiple spawner with asynchronous development (Ref. 12343). The flesh is soft and trawled fish are frequently bruised (Ref. 6205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: endemic to Australian waters from Fremantle northward to Shark Bay (western population), and from southern Queensland to New South Wales (eastern population).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 16 - 18; Analspines: 2; Analsoft rays: 16 - 19; Vertebrae: 33
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 6205))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The base of the first dorsal-fin spine yellow and the remainder of its keel dark brown to blackish. A silvery stripe runs midlaterally on the sides, and a yellow blotch is on the cheek.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 10 - 70 m (Ref. 6205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 21 - 63
  Temperature range (°C): 25.679 - 26.503
  Nitrate (umol/L): 0.385 - 2.179
  Salinity (PPS): 34.701 - 35.100
  Oxygen (ml/l): 4.168 - 4.536
  Phosphate (umol/l): 0.175 - 0.378
  Silicate (umol/l): 3.468 - 7.567

Graphical representation

Depth range (m): 21 - 63

Temperature range (°C): 25.679 - 26.503

Nitrate (umol/L): 0.385 - 2.179

Salinity (PPS): 34.701 - 35.100

Oxygen (ml/l): 4.168 - 4.536

Phosphate (umol/l): 0.175 - 0.378

Silicate (umol/l): 3.468 - 7.567
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 70m.
From 10 to 70 meters.

Habitat: demersal. Occurs in bays and estuaries, but more commonly in deep offshore waters (Ref. 9563). Inhabits sandy substrates. Juveniles feed mainly on crustaceans such as copepods and mysidaceans, whereas larger fishes (11-20 cm) consume more polychaetes (Ref. 6223). Sexually mature below 13 cm SL and rarely exceeds 17 cm in Western Australia. The flesh is soft and trawled fish are frequently bruised (Ref. 6205).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Multiple spawner with asynchronous development (Ref. 12343).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sillago robusta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTCGGAGCCTGAGCAGGTATAGTAGGCACAGCCCTAAGCCTGCTTATTCGAGCAGAACTAAGCCAACCTGGTGCTCTGCTTGGAGACGACCAAATCTACAATGTTATTGTTACGGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCCTAATCGGTGGTTTCGGAAACTGACTAGTCCCACTAATGATTGGGGCCCCTGACATGGCCTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCACCTTCCTTCCTACTCCTTCTCGCCTCATCTGGAGTTGAAGCAGGGGCTGGAACCGGATGAACAGTATACCCTCCTTTAGCCGGAAACTTAGCTCACGCAGGAGCTTCCGTCGACCTAACTATTTTCTCCTTACACTTAGCCGGAGTTTCCTCTATTCTAGGGGCAATTAACTTTATTACAACCATCATCAACATAAAACCTCCAGCAATTTCACAATACCAAACTCCCTTATTTGTTTGATCTGTTCTAATTACAGCCGTCCTCCTACTACTCTCACTGCCAGTACTTGCAGCAGGAATTACAATGCTTCTCACAGACCGAAACCTGAACACTACCTTTTTCGATCCTGCTGGTGGTGGTGACCCTATTCTTTACCAGCACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sillago robusta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Stout whiting

The stout whiting, Sillago robusta (also known as the yellow-cheek whiting and school whiting), is a species of benthic marine fish in the smelt-whiting family Sillaginidae. Like other sillaginids, it is an elongate, slightly compressed fish, growing to a maximum known length of 30 cm. The stout whiting is endemic to Australia, with the species divided into western and eastern populations, with the western population ranging from Shark Bay to Fremantle and the eastern population from Bustard Head, Queensland to northern New South Wales. The species inhabits deep, sandy continental shelf regions to a depth of at least 70 m. The stout whiting is a benthic carnivore, consuming a variety of polychaetes and crustaceans. The species grows rapidly, and sexual maturity is reached at a length of 13 cm, with spawning occurring between December and March. Juveniles of the eastern population move to protected inshore waters, while those of the western population remain offshore their entire life. Stout whiting are the subject of a major export fishery operating out of southern Queensland and to a lesser extent New South Wales, with fishery authorities limiting the yearly catch to 1000 tonnes in Queensland. Most of the catch is exported frozen to a number of Asian countries, although small quantities are sold in Australia, with the net worth of the fishery values at around 3 million Australian dollars per year.

Taxonomy and naming[edit]

The stout whiting is one of 29 species in the genus Sillago, which is one of three divisions of the smelt whiting family Sillaginidae. The smelt-whitings are Perciformes in the suborder Percoidea.[1]

The species was first scientifically described by Stead in 1908 based on a specimen collected from Rose Bay in Port Jackson, New South Wales, which was designated to be the holotype.[2] After this description and naming, the species was once again described and named by William Ogilby in 1910 as Sillago auricomis, based on a specimen taken from near Hervey Bay in Queensland. This is considered to be junior synonym under ICZN naming rules and has subsequently been discarded.[3] During a comprehensive revision of the sillaginids in 1985, Roland McKay noted that the eastern and western populations of fish varied slightly in their fin osteology and swimbladder morphology, but recommended a full osteological comparison before placing them in subspecies ranks. McKay also postulates that the two populations became separated during the last ice age, when a land bridge closed the Torres Strait to the movement of the species.[4]

The species is most commonly known as the 'stout whiting', and is recognised as such by the Australian Government.[5] The species is occasionally called the 'yellow-cheek whiting' and also 'school whiting', a broad name applied to a number of Australian sillaginids.[6]

Description[edit]

The stout whiting is similar in appearance to a number of Australian sillaginids, with dorsal fin and swimbladder morphology the best identification features. It is a small fish, reaching a known maximum length of 30 cm,[7] but more commonly seen below 23 cm. Like most sillaginids, the stout whiting has a slightly more convex dorsal profile compared to the ventral profile, reflecting the benthic nature of the species. The dorsal fin is composed of 2 sections; the first consisting of 11 spines and the second of 1 spine followed by 16 to 18 soft rays. Large specimens show a distinct anterior keel on the first spine of the first dorsal fin, with this feature being more pronounced in the eastern population.[4] The anal fin is similar to the second dorsal fin, having 2 spines followed by 16 or 19 soft rays.[7] The lateral line has 65-70 scales, whilst the cheek has 2 to 3 rows of cteniod scales, and there are 33 vertebrae in total. The swimbladders of the two populations are slightly different, with the eastern population having small anterolateral extensions, while the western population lack these. There is a single tapering posterior extension and a duct like process which runs from the ventral surface to the urogenital opening.[4]

In life, the stout whiting is a creamy yellow to sandy pink colour dorsally, with a silvery white with mauve reflections ventrally. The dorsal and ventral colours are sharply separated by a silvery mid lateral band that is often only weakly visible. The body and fins are devoid of any dark markings, with the only breaks in colouration being yellow blotches on the cheeks and a yellow blotch on the base of the first dorsal fin.[4] The first dorsal fin has a white base, becoming darker dorsally, while the anal fin is white, becoming more yellow at the base of the fin. The caudal fin is a pale lemon yellow with a speckled margin, the pelvic fins are white to hyaline and the pectoral fins are hyaline. There have been records of geographical variation in colour amongst the species, especially within Shark Bay. The Shark Bay fish may have faint gold bars trending 50 degrees above the mid lateral silvery band, and may have black dusting on the dorsal and anal fins.[4]

Distribution and habitat[edit]

Stout whiting are endemic to Australia, and consist of two apparently disjunct populations; one on the eastern seaboard, the other on the western seaboard. The eastern population has a wider distribution, inhabiting waters from Bustard Head, Queensland to southern New South Wales. The western population exists from Shark Bay in the north to Fremantle in the south.[3] In his 1985 revision of the Sillaginidae, McKay reported the species from as far north as the Gulf of Carpentaria,[4] but did not mention any specimen from this far north in his follow-up catalogue for the FAO.[7]

Stout whiting are found in deeper waters than other Australian sillaginids, inhabiting sandy substrates at depths of 10 to 70 m. juvenile fish of the eastern population inhabit shallower waters for the first year of life, often in large bays and near surf beaches. The fish of the western population spend their entire lives offshore.[8] In northern Australia, the same offshore niche is occupied by the mud whiting, Sillago lutea.[4] In southern Queensland, where it coexists in deeper waters with S. flindersi, the stout whiting shows preference for deep sandy strata with a riverine influence.[9]

Biology[edit]

Due to the emergence of stout whiting as a major east coast fishery, a number of detailed studies have been undertaken to determine the reproductive and growth characteristics of the species in southern Queensland, while a series of studies in southern Western Australia have focused on the diet and movements of the species in relation to the ecology of coexisting sillaginids. Like most smelt-whitings, the stout whiting is a schooling species, occasionally associating with S. vitttata, S. burrus and S. bassensis in southern Western Australia and with S. flindersi in southern Queensland. The species is thought to form large schools mostly at dawn and dusk.

Diet and feeding[edit]

Stout whiting are benthic predators that forage the sea floor using their protrusile jaws to 'suck up' prey from the substrate. Research conducted in southern Queensland indicates the species preys mostly on crustaceans and polychaete worms. Individuals less than 10 cm predominantly consume small crustaceans such as copepods and mysids, while older fish took more polychaetes. Amphipods and the shrimp genus Callianassa were also commonly taken in this study. In southern Queensland, there is also a strong temporal control on the diet, with summer months showing much higher polychaete intake compared to crustaceans and vice versa in winter. A detailed study in southern Western Australia indicated amphipods and polychaetes are the two primary components of this population's diet. Penaeids, ostracods, ophiuroid echinoderms and a variety of molluscs also make up a significant part of the species diet in this area.[10] Once again, larger fish took more polychaetes, and in general broadened their diet with increasing age. This resulted in a low dietary overlap with other coexisting sillaginids present in the same area.[10]

The stout whiting is also a major prey species itself for a number of species, with seals, dolphins and larger fish known predators of the species.

Reproduction and growth[edit]

The stout whiting reaches sexual maturity by the end of its second year of life, with around 50% of fish accomplishing this after only one year. The fish are around 13 cm once they reach sexual maturity.[11] The patterns of spawning and movement of the juveniles differs between the eastern and western populations. In the western population, unlike many co-occurring sillaginids, stout whiting do not move inshore to spawn and the juveniles do not make their way to shallower waters; instead they spawn offshore, with the fish spending their entire lives in this environment.[12] In contrast, the eastern population do use inshore nursery areas for the juveniles including bays and surf beaches, with this difference between populations attributed to increased competition between sillaginids by some authors. In both populations, spawning occurs over summer, with the fish spawning multiple times between December and March.[11][13]

Stout whiting are fast growers in comparison to most other smelt-whitings, reaching 80% of its final length after 2 years of life. The species is known to reach a maximum age of 7 years, although most individuals do not survive more than 3 years.[11]

Relationship to humans[edit]

Stout whiting, like most of the smelt-whitings are considered to be good quality table fish, although have soft flesh which results in a tendency to bruise easily. Due to their mostly offshore nature and small size, they are rarely targeted or caught by recreational fishermen, who take an estimated 1 tonne per year. They are however are a major target for commercial operators, especially in southern Queensland.[14] The Queensland fishery originated in 1981, after a single operator began targeting eastern school whiting, S. flindersi. It was soon discovered that stout whiting were highly abundant in the surrounding region and the fishery began to shift towards the species. The original operator who realised the potential of the fishery continued after the market took a downfall, upgrading equipment with a new snap freezing facility, which became essential for exporting the fish. There was a rapid expansion in the fishery between 1989 and 1990, with 10 operators recording a 1789 tonne haul in 1990. In 1991 the market once again took a downfall due to low demand, and the fishery is now closely monitored by fishery authorities, with a 1000 tonne limit on the total yearly catch in place since 2000.[15] This limit includes the fish taken as bycatch in other fisheries such as prawn trawling, which means often a sizable amount must be discarded.[16]

In New South Wales, stout whiting were mostly discarded by trawlers until an export market developed in the 1970s. Substantial amounts are taken and mostly discarded by prawn trawlers, and the catch has been stable at around 300-500 tonnes per year since 2000.[17] The western population is not highly exploited.

The fishery is worth a reported 3 million Australian dollars annually (around $2.80 per kg in 1999), with the fish exported to Thailand, China, Vietnam, Japan and Taiwan. These exported fish compete with local Asian sillaginids, especially northern whiting and Japanese whiting, resulting in substantial price fluctuations. Few fish make their way to local markets where they are sold as butterfly fillets.[14]

References[edit]

  1. ^ "Sillago robusta". Integrated Taxonomic Information System. Retrieved May 2008. 
  2. ^ Hosese, D.F.; Bray, D.J., Paxton, J.R. and Alen, G.R. (2007). Zoological Catalogue of Australia Vol. 35 (2) Fishes. Sydney: CSIRO. p. 1126. ISBN 978-0-643-09334-8. 
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2008). "Sillago robusta" in FishBase. Jun 2008 version.
  4. ^ a b c d e f g McKay, R.J. (1985). "A Revision of the Fishes of the Family Sillaginidae". Memoirs of the Queensland Museum 22 (1): 1–73. 
  5. ^ Fisheries Research & Development Corporation (2006). "Fish.gov.au". Stout whiting. Australian Government. Retrieved 2007-07-21. 
  6. ^ ZipcodeZoo.com (April 24, 2008). "Sillago robusta". Retrieved 2008-06-11. 
  7. ^ a b c McKay, R.J. (1992). FAO Species Catalogue: Vol. 14. Sillaginid Fishes Of The World. Rome: Food and Agricultural Organisation. pp. 19–20. ISBN 92-5-103123-1. 
  8. ^ Hyndes, G.A.; Platell, M. E., Potter, I.C. & Lenanton, R.C.J. (1999). "Does the composition of the demersal fish assemblages in temperate coastal waters change with depth and undergo consistent seasonal changes?". Marine biology (Springer-Verlag) 134 (2): 335–352. doi:10.1007/s002270050551. 
  9. ^ Burchmore, J.J.; D. A. Pollard, M. J. Middleton, J. D. Bell and B. C. Pease (1988). "Biology of Four Species of Whiting (Pisces : Sillaginidae) in Botany Bay, New South Wales". Australian Journal of Marine and Freshwater Research 39 (6): 709–727. doi:10.1071/MF9880709. 
  10. ^ a b Hyndes, G.A.; M. E. Platell & I. C. Potter (1997). "Relationships between diet and body size, mouth morphology, habitat and movements of six sillaginid species in coastal waters: implications for resource partitioning". Marine Biology (Berlin/Heidelberg: Springer) 128 (4): 585–598. doi:10.1007/s002270050125. 
  11. ^ a b c Hyndes, G.A.; Potter, I.C. (1996). "Comparisons between the age structures, growth and reproductive biology of two co-occurring sillaginids, Sillago robusta and S. bassensis, in temperate coastal waters of Australia". Journal of Fish Biology (Blackwell Publishing) 49 (1): 14–32. doi:10.1111/j.1095-8649.1996.tb00002.x. Retrieved 2008-07-21. 
  12. ^ Hyndes, Glenn A.; Ian C. Potter (1997). "Age, growth and reproduction of Sillago schomburgkii in south-western Australian, nearshore waters and comparisons of life history styles of a suite of Sillago species". Environmental Biology of Fishes (Netherlands: Kluwer Academic Publishers) 49 (4): 435–447. doi:10.1023/A:1007357410143. 
  13. ^ Butcher, A.R.; Hagedoorn, W.L. (2003). "Age Growth and Mortality Estimates of Stout Whiting, Sillago robusta Stead (Sillaginidae), from Southern Queensland, Australia". Asian Fisheries Science (Manila, Philippines: Asian Fisheries Society) 16: 215–228. Retrieved 2008-07-21. 
  14. ^ a b O' Neill, M.; Kate Yeomans, Ian Breddin, Eddie Jebreen & Adam Butcher (March 2002). The Queensland Stout Whiting Fishery: 1991 to 2002. DPI, Queensland Government. pp. 1–52. 
  15. ^ McCormack, Catherine (January 2006). Annual Status Report 2005: Finfish (Stout Whiting) Trawl Fishery. Queensland Government Department of Primary Industries. pp. 1–17. ISSN 0727-6273. [dead link]
  16. ^ Courtney, A.J.; M.L. Tonks, M.J. Campbell, D.P. Roy, S.W. Gaddes, P.M. Kyne & M.F. O'Neill (2006). "Quantifying the effects of bycatch reduction devices in Queensland’s (Australia) shallow water eastern king prawn (Penaeus plebejus) trawl fishery". Fisheries Research (Elsevier) 80 (2-3): 136–147. doi:10.1016/j.fishres.2006.05.005. 
  17. ^ Wild Fisheries Research Program (2008). Status of Fishery Resources in NSW 2006/07: Stout Whiting. New South Wales Department of Primary Industries. pp. 1–3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!