Overview

Comprehensive Description

Biology

Inhabit rocky pools of headwaters and creeks. Individuals are usually found along undercut banks, around large rocks or among detritus (Ref. 3814, 10294). Feed on attached algal growth and aquatic insect immatures (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (1000-5000 square km (about 400-2000 square miles)) Range includes small tributaries in the Cumberland Plateau portion of the upper Cumberland River above Cumberland Falls and a few kilometers below (Etnier and Starnes 1993), in Pulaski, Laurel, McCreary, Whitley, Knox, Bell, Harlan, and Letcher counties in Kentucky, and Scott, Campbell, and Claiborne counties in Tennessee (USFWS 1988). The species also occurs in Cox Creek, a small tributary of the North Fork Powell River in Lee County, Virginia (though this population could turn out to be an undescribed species) (2001 Endangered Species Bulletin 25(3):39). Page and Burr (2011) did not mention Virginia in their range description.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: upper Cumberland River drainage (above Big South Fork) in Kentucky and Tennessee, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Blackside dace (Chrosomus cumberlandensis) are found in approximately 40 tributaries of the Cumberland River in Pulaski, Laurel, McCreary, Whitley, Knox, Bell, Harlan, and Letcher counties in Kentucky, and Scott, Campbell, and Claiborne counties in Tennessee (NatureServe, 2005) and have been recently discovered in the upper Clinch River drainage in Lee County, Virginia (Pinder, M.J., personal communication). A survey of 168 upper Cumberland River streams, by Starnes and Starnes (1981) found the species to occur in 27 different drainages. A survey by O’Bara (1985) found blackside dace in 30 of 193 upper Cumberland River drainages.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Kentucky and Tennessee, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Blackside dace have an incomplete lateral line with 66 to 81 lateral line scales (Etnier and Starnes, 1993). Anal fin ray count is 8 to 9 and pectoral fin rays range from 14 to 16 (Etnier and Starnes, 1993). Adults range from 50 to 65 mm during the end of the second and third summers and can reach a maximum length of 76 mm (Etnier and Starnes, 1993). Adults have a single black lateral stripe or two stripes converging on the caudal peduncle, a green/gold dorsum with black speckling and a pale to brilliant scarlet belly (Biggins, 1988; Etnier and Starnes, 1993). The fins are often bright yellow with metallic silver surrounding the base of the pelvic and pectoral fins (Biggins, 1988). The yellowish fins seem to be associated with the breeding season (Etnier and Starnes, 1993). The male is more colorful and can be distuingished from the female by having a golden dorsum and well developed tubercles on the pectoral fins during the breeding season (Etnier and Starnes, 1993).

A similar species that can be found in the same watershed as blackside dace is southern redbelly dace (Chrosomus erythrogaster). Blackside dace are differentiated from southern redbelly dace by a single black lateral stripe or two stripes that converge on the caudal peduncle, where southern redbelly dace have two parallel lateral stripes (Etnier and Starnes, 1993).

Juvenile blackside dace can be confused with juvenile creek chub (Semotilus atromaculatus) and juvenile blacknose dace (Rhinichthys atratulus) (Etnier and Starnes, 1993). Creek chub are more robust and have only 51 to 54 lateral line scales, and blacknose dace are differentiated by having a frenum (Etnier and Starnes, 1993).

Range length: 76 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennessee. Knoxville, TN: University OF Tennessee Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 72 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.6 cm TL (male/unsexed; (Ref. 10294)); max. reported age: 4 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Phoxinus cumberlandensis Starnes & Starnes
Catalog Number: USNM 217810
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Starnes & L. Starnes
Year Collected: 1976
Locality: Youngs Creek At Gravel Road 0.8 km. W. of Us 25w, 10.7 Air km. N.W. of Williamsburg Whitley Co., Ky., Whitley County, Kentucky, United States, North America
  • Paratype: Starnes, W. C. & Starnes, L. B. 1978. Copeia. 1978 (3): 508.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species inhabits small upland headwaters and creeks 2-5 meters wide where riffle and pool areas are about equal, and substrates are sand, sandstone, and shale (Burr and Warren 1986, Etnier and Starnes 1993). It occurs in pools with cover such as bedrock, rubble, undercut banks, or brush, and generally is associated with lush riparian vegetation, canopy cover greater than 70%, cool water, and unsilted conditions. The species can apparently recolonize areas when water quality or habitat conditions become more favorable if suitable dispersal corridors exist (Strange and Burr 1995). Blackside dace exist as metapopulations (groups of local populations for which dispersal corridors are very important in the persistence of individual local populations) (Strange and Burr 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Blackside dace inhabit small to medium sized streams 2.1 to 4.6 meters in width, with moderate gradient, and rarely exceeding 21 degrees Celsius (70 degrees Fahrenheit) (Biggins, 1988). According to O’Bara (1985), blackside dace occur in only moderate gradient streams that have a 60:40 riffle-pool ratio. Substrate in these streams consists of cobble-gravel in riffles and bedrock-boulder-silt in pools (O’Bara, 1985). Starnes and Starnes (1981) note that these fish are generally associated with undercut stream banks and large rocks, and they are usually found in drainages with well-vegetated watersheds and riparian zones. The riparian vegetation generally associated with blackside dace habitat includes woody species such as eastern hemlock (Tsuga canadensis), giant rhododendron (Rhododendron maximum), ironwood (Carpinus caroliniana), river birch (Betula nigra), and American sycamore (Platanus occidentalis) (O’Bara, 1985). Canopy cover at stream sections that support blackside dace is usually over 70 percent (O’Bara, 1985).

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: benthic ; rivers and streams

  • Biggins, R. 1988. Blackside Dace Recovery Plan. Atlanta, GA: U.S. Fish and Wildlife Service.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Ingests detritus, diatoms, algae, and (seasonally) insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabit rocky pools of headwaters and creeks. Individuals are usually found along undercut banks, around large rocks or among detritus (Ref. 3814, 10294). Feed on attached algal growth and aquatic insect immatures (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Blackside dace feed on algae attached on the stream substrate and potentially beneath banks of the stream (Etnier and Starnes, 1993). According to Etnier and Starnes (1993) blackside dace feed on insect larvae during the winter when algae is less abundant.

Animal Foods: insects

Plant Foods: algae

Primary Diet: herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Blackside dace are primary consumers, feeding mainly on algae. They serve as a food source for carnivores, particularly larger fishes, and may occasionally themselves be predators on aquatic insect larvae (USFWS, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Jones and Mattingly (2003) have noted a negative correlation between blackside dace and both redbreast sunfish and largemouth bass abundance that may be due to a predator-prey interaction.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: This species is represented by a large number of occurrences (subpopulations). At the time of federal listing, the species was known to occupy about 14 stream miles (23 kilometers) in 30 separate streams (USFWS 1987, 1988). Subsequently Williams et al. (1989) reported that populations occurred in 35 isolated stream reaches totaling 27 kilometers. Extensive surveys in 1993 documented the presence of at least 27 more streams containing blackside dace (Eisenhour and Stange 1998). Subsequent surveys (see following) have found this dace in additional streams.

In Kentucky, the species is known from at least 91 streams; during a 1993-1994 survey the species was verified extant in 72 streams, but only 22 streams supported excellent or good populations; most populations were very small and near extirpation (Laudermilk data).

In Tennessee, this dace has been documented in at least a couple dozen localities, but these may represent only a few metapopulations or population clusters (P. Shute, pers. comm., 1997). Etnier and Starnes (1993) reported that only six small populations were then known to occur in Tennessee.

Populations of this species are relatively mobile; if extirpated may, recolonize in a short time, provided appropriate habitats for refugia and dispersal routes are available (P. Shute, pers. comm., 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 - 100,000 individuals

Comments: Total adult population size is unknown but probably is at least several thousand. Most populations are small and consist of only a few individuals in short (0.1-1.0 kilometers) segments of suitable habitat (O'Bara 1990). The densest populations include an estimated 55-75 individuals per 100 square meters of stream (Starnes and Starnes 1981).

During a 1993-1994 survey in Kentucky, approximately 1,065 individuals were observed; many streams where this species is known to occur were not intensively surveyed; one intensively surveyed site produced over 500 individuals (Laudermilk data).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Blackside dace use vision, hearing and chemoreception. In addition, they use their lateral line system to detect vibrations in the water, which may help them avoid predators (Helfman et al., 1997).

Little is known about intraspecific communication in blackside dace.

Communication Channels: visual ; tactile

Perception Channels: visual ; vibrations

  • Helfman, G., B. Collette, D. Facey. 1997. The Diversity of Fishes. Malden, MA: Blackwell Science, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Little is known about the early development of blackside dace. A life span of three years is typical, with fry growing to about 30 mm by the first fall of life and reaching sexual maturity by their first spring (Etnier and Starnes 1993). During the second and third year, total lengths average 50 to 60 mm, with a maximum total length of 76 mm (Etnier and Starnes, 1993). Size ranges are broken into three age classes, which include the following: Age 0: 30 to 39 mm, Age I: 40 to 59 mm, and Age II: 60 to 79 mm (O’Bara, 1985). Biologists use the age classes to determine if blackside dace populations are reproducing and viable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of blackside dace is approximately 3 years (Etnier and Starnes, 1993).

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in May and June. Life span probably is 3 or 4 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about the mating systems of blackside dace. Spawning occurs during the spring, from April to June. Males gather in small groups during spawning and several males fertilize the eggs of each female as she deposits them (USFWS, 1991).

Mating System: polygynandrous (promiscuous)

Blackside dace spawn from April through June, but the majority of spawning occurs during May (Starnes and Starnes, 1981). During spawning, males develop tubercles and both males and females develop brilliant colors (Etnier and Starnes, 1993). Spawning typically occurs over silt-free gravel in the nests of other cyprinid fish, but presumably riffle areas are used when these nests are not present (Etnier and Starnes, 1993). Females deposit an average of 1,540 ova during spawning (O’Bara, 1985).

Breeding interval: Blackside dace spawn once a year.

Breeding season: Blackside dace spawn each April through June.

Average number of offspring: 1540.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Little is known about parental investment in blackside dace. Once the eggs are fertilized and deposited, there is no further parental involvement.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennessee. Knoxville, TN: University OF Tennessee Press.
  • U. S. Fish and Wildlife Service. 1991. "Species account for blackside dace (Chrosomus cumberlandensis)" (On-line). Endangered and Threatened Species of the Southeastern United States (The Red Book) FWS Region 4. Accessed September 06, 2006 at http://www.fws.gov/endangered/i/e/sae2g.html.
  • O'Bara, C. 1985. Status survey of the blackside dace Chrosomus cumberlandensis . Asheville, NC: U.S. Fish and Wildlife Service.
  • Starnes, W., L. Starnes. 1981. Biology of the blackside dace Chrosomus cumberlandensis . American Midland Naturalist, 106: 360-370.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrosomus cumberlandensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTTGGTGCCTGAGCAGGAATGGTGGGAACCGCTTTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGATCACTACTAGGTGATGACCAAATTTATAACGTTATTGTTACTGCCCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGCGGATTTGGAAACTGACTCGTACCCCTAATAATTGGTGCACCCGACATAGCATTTCCCCGAATAAATAATATAAGCTTTTGACTTCTACCCCCATCATTCCTCCTATTGCTAGCTTCTTCTGGTGTCGAGGCTGGGGCCGGGACAGGATGAACAGTGTATCCCCCACTCGCAGGCAATCTGGCCCATGCGGGGGCATCTGTAGACCTAACAATTTTCTCCCTCCATCTAGCAGGTGTATCATCAATTTTAGGGGCCGTAAATTTTATTACCACAATCATCAACATAAAACCCCCAGCTATTTCCCAATATCAAACCCCTCTTTTCGTCTGAGCCGTACTTGTCACGGCCGTCCTGCTTCTTCTATCTCTACCAGTGCTAGCTGCCGGAATTACAATACTTCTTACAGATCGTAATCTTAATACCACATTCTTTGACCCGGCAGGAGGAGGGGACCCAATTTTATACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrosomus cumberlandensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Small range in tributaries of the upper Cumberland River in Kentucky and Tennessee, and in a tributary of the North Fork Powell River in Virginia; range has been reduced and fragmented by surface coal mining; populations occur in several dozen small, isolated stream reaches; threatened by siltation caused by human activities, impacts of unregulated acid mine drainage, impoundments, and possibly competition from an introduced dace.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Gimenez Dixon, M.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Blackside dace are listed by the United States Fish and Wildlife Services as Threatened, and are protected under the Endangered Species Act.

Habitat degradation caused by strip mining and logging practices seem to be the leading cause of the decline in numbers of blackside dace. Blackside dace occur in the coalfields of southeastern Kentucky and inhabit headwater streams where these activities have the most impact.

Through the pre-mine permitting process, state and federal agencies restrict or highly regulate mining activities that are to occur in watersheds containing blackside dace.

US Federal List: threatened

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Current trends are not well known, but area of occupancy, number of subpopulations, and population size appear to be declining or at least many subpopulations are vulnerable to extirpation. Many populations in Kentucky are extremely small or isolated and near extirpation (Laudermilk data), so probably the species is declining in that state. The species is believed to be stable in Tennessee, but it is susceptible to rapid fluctuations in population size and distribution (P. Shute, pers. comm., 1997). Etnier and Starnes (1993) characterized the remaining populations in Tennessee as "all very localized and vulnerable to extirpation...." Many streams that formerly supported populations have been destroyed; status of populations has fluctuated greatly over the past decade (Shute et al., unpublished data).

Global Long Term Trend: Decline of 30-70%

Comments: Historical distribution was likely much more continuous than at present, but the degree of decline is uncertain. Now small populations are isolated from each other by extremely degraded habitat. The species has been extirpated from at least 10 streams (O'Bara 1990), and probably many others were extirpated before they could be discovered (Starnes and Starnes 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Threatened status is due primarily to impacts of siltation from coal mining, silviculture, agriculture, and road construction, and impacts of unregulated acid mine drainage and impoundments; these factors still constitute a threat (USFWS 1987, 1988). Additional threats include channelization and non-point source pollution (Laudermilk 1995). The southern redbelly dace (Phoxinus erythrogaster), a comparatively more recent (geologically) component of the upper Cumberland River basin fauna, is now present in many basin streams (Starnes 1981, Starnes and Starnes 1987). The redbelly dace is believed to have outcompeted and displaced blackside dace from some stream habitats where the water and habitat quality have been altered (i.e., stream bank modification, channel modification, and forest cover modification) to create warmer and more turbid conditions (Starnes 1981). Introductions of non-native predaceous fishes (e.g., Oncorhynchus mykiss) may have a negative effect on the remaining populations (Leftwich et al. 1995). Remaining populations are small and isolated from each other by extremely degraded habitat, and the exchange of genetic material among some of these populations is likely infrequent or nonexistent. If isolation continues, some of the smaller populations may have insufficient genetic variability to maintain long-term viability (USFWS 1988). Site visitation is not detrimental (P. Shute, pers. comm., 1997). The species is regarded as very threatened in Tennessee (Peggy Shute, pers. comm., 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (D2)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Spawning protocols are being established (J. R. Shute and P. L. Rakes, pers. comm., cited by Eisenhour and Stange 1998), in case reintroduction becomes necessary.

Biological Research Needs: The minimum number of individuals needed for a viable population needs to be determined. Better information is needed on the extent genetic exchange occurring between small, isolated populations (Laudermilk. Analysis of stream habitat requirements would be useful in linking habitat use patterns to potential changes in land use within a watershed (Leftwich et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Kentucky streams that receive a high degree of protection include the Bad Branch, Eagle Creek, Watts Creek, Beaver Creek and associated tributaries, and Davis Branch; several streams occur on Daniel Boone National Forest, but these do not receive the same high degree of protection as the previously mentioned streams; Cannon Creek is protected to some degree, designated unsuitable for mining (Laudermilk).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Mineral extraction is negatively impacted economically because mining companies cannot disturb streams containing blackside dace, which are then designated as Outstanding Resource Waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Blackside dace have no economic value to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: This species appears to be intolerant of surface coal mining; these activities should be discontinued in dace-occupied basins (Eisenhour and Strange 1998). Wide riparian zones need to be maintained, land management practices that minimize siltation should be implemented (Eisenhour and Strange 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blackside Dace

The Blackside Dace (Chrosomus cumberlandensis (syn. Phoxinus cumberlandensis)[1]) is a species of ray-finned fish in the family Cyprinidae. It is endemic to the Cumberland River drainage in Kentucky and Tennessee as well as the Powell River drainage in Virginia in the United States. It is a federally listed threatened species.[2]

This fish is 50 to 65 millimeters in length. It is olive green in color with black speckling and a black stripe. During the breeding season in April through July the stripe becomes a deeper black, there are red areas on the upper parts, and the fins become yellow.[3]

This fish is found in 105 streams in Kentucky and Tennessee, but many of these populations are very small, with under 10 individuals. The species has been found in western Virginia, but these populations are believed to have been introduced by people.[3]

The fish lives in cool, clear streams with rocky substrates and overhanging vegetation. It is schooling and lives under banks and rock formations. Other fish in the habitat include the common creek chub (Semotilus atromaculatus), white sucker (Catostomus commersoni), stoneroller (Campostoma anomalum), and stripetail darter (Etheostoma kennicotti). The dace eats algae and sometimes insects. It lives 2–3 years and becomes sexually mature in its first year.[4] The female lays an average of 1540 eggs.[5]

The species is threatened by the loss and degradation of its habitat. The rocky riverbed substrates in which it spawns are degraded by erosion and sedimentation, which are increased by human activities such as runoff pipes from septic tanks, and trash being dumped into streams. Several populations have been extirpated by these processes.[4]

On August 2013, the U.S. Geological Survey released together with the U.S. Fish and Wildlife Service a study which shows that after the spill of fracture-fluid an important number of fish and other water being, including the Blackside Dace, died. It is a result of extremely high stream conductivity of about 35.000 microsiemens and a ph-value of 5,6, which indicate that the water is extreme charged with metals.[6]

References[edit]

  1. ^ Chrosomus cumberlandensis. FishBase.
  2. ^ USFWS. Determination of threatened species status for Blackside Dace. Federal Register June 12, 1987.
  3. ^ a b Johnson, T. D., et al. Blackside Dace Phoxinus cumberlandensis Species account and Cumberland Habitat Conservation Plan (HCP) survey results.
  4. ^ a b Eisenhour, D. J. and R. M. Strange. (1998). Threatened fishes of the world: Phoxinus cumberlandensis Starnes & Starnes, 1978 (Cyprinidae). Environmental Biology of Fishes 51(2) 140.
  5. ^ Starnes, L. B. and W. C. Starnes. (1981). Biology of the Blackside Dace Phoxinus cumberlandensis. American Midland Naturalist 106(2) 360-71.
  6. ^ U.S. Geological Survey
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Starnes and Starnes (1978) for original description. A population in Cox Creek, Lee County, Virginia, may represent an undescribed species.

This species formerly was included in the genus Phoxinus. Based on patterns of genetic variation, Strange and Mayden (2009) reassigned all North American Phoxinus species to the genus Chrosomus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!