Overview

Comprehensive Description

Stomias boa (Risso, 1810)

Sea of Marmara : 5200-92 (1 spc.), 23.06.1955 , Offshore of Yalova-Tuzla, 860 m , M. Demir .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 37-37, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Nice, Département des Alpes-Maritimes, France, northwestern Mediterranean Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type specimen(s)

Holotype: MNHN A-2519. Possible syntype: SMF 753.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Main Reference

Gibbs RH, Jr. 1984. Stomiidae. In: Whitehead PJP, Bauchot M-L, Hureau J-C, Nielsen J, Tortonese E, editors. Fishes of the North-eastern Atlantic and the Mediterranean. Paris: UNESCO. p 338–340.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Stomias boa is a common predator of meso- and bathypelagic oceanic waters. Two subpecies are recongnized: S. boa boa, known from the western Mediterranean, off West Africa and in the Southern Ocean, and S. boa ferox, known throughout much of the subtropical, tropical, and temperate Atlantic.. These taxa are distinguished by the number of photophores in the ventral row (see "Diagnostic Description").

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Temperate, subtropical, and tropical oceanic waters of the Atlantic; also in the Southerd Ocean and temperate latitudes of the Indian Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern circumglobal; eastern Atlantic from Portugal to South Africa, including Mediterranean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Species of the genus Stomias are very elong and slender, with large jaws bearing fang-like teeth and a moderately long and posteriorly place dosrsal fin. Species of the genus are distinguished from other genera in the family Stomiidae by the following characters. Upper jaw extending to near anterior margin of preoperculum; premaxilla proctractile. Hyoid barbel long and slender, terminal bulb and filaments at tip. Maxilla with numerous small teeth on posterior half of ventral margin. Vomer with pair of teeth; palatine bearing one to three teeth. Gill arches bearing tack-like teeth rather than rakers. Floor of mouth present, membrane connecting halves of lower jaw to isthmus. Pectoral fin placed low on body; pelvic fin indserted nearer to caudal-fin base than to snout. Anal and dorsal fins opposite and placed far posteriorly on body. Dorsal adipose fin absent

Photophores present below eye, on brahciostegal membrane, in ventral row from isthmus to caudal-fin base and in lateral row from posterior margin of opercle to anal-fin origin; small luminescent organs scattered over head and body. Body covered with five or six rows of hexagonal scale pockets, and, when undamaged, covered with gelationous coat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 322 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To more than 30 cm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Barbel usually about as long as head, with 3 short filaments arising from end of distal bulb; upper jaw with a small anterior tooth, a large fang and 3 to 5 smaller teeth; lower jaw with 2 small anterior teeth, 2 large teeth and 3 to 7 smaller teeth. Six rows of hexagonal areas above lateral series of large photophores; 82–91 photophores in ventral series (IC, from anterior end of isthmus to fleshy part of tail). Color iridescent silver.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Stomias boa
Catalog Number: USNM 170953
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1928
Locality: Hudson Gorge, 125 Miles SE. of N.Y. City, New Jersey, United States, Atlantic
Vessel: Wheeler
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1030 specimens in 4 taxa.
Water temperature and chemistry ranges based on 917 samples.

Environmental ranges
  Depth range (m): -9 - 5100
  Temperature range (°C): 0.279 - 22.330
  Nitrate (umol/L): 0.158 - 44.278
  Salinity (PPS): 32.279 - 39.011
  Oxygen (ml/l): 0.259 - 7.198
  Phosphate (umol/l): 0.034 - 3.220
  Silicate (umol/l): 0.859 - 163.066

Graphical representation

Depth range (m): -9 - 5100

Temperature range (°C): 0.279 - 22.330

Nitrate (umol/L): 0.158 - 44.278

Salinity (PPS): 32.279 - 39.011

Oxygen (ml/l): 0.259 - 7.198

Phosphate (umol/l): 0.034 - 3.220

Silicate (umol/l): 0.859 - 163.066
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Deep oceanic waters to more than 1,000 m depth; may migrate to near-surface waters at night

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Midwater fishes and crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stomias boa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTATTTGGTGCTTGAGCTGGTATGGTCGGCACAGCTTTAAGCCTGCTTATTCGGGCGGAGCTAAGTCAACCCGGCGCCCTCCTAGGCGACGACCAGATTTACAACGTAATCGTTACTGCACACGCCTTCGTGATAATTTTCTTTATAGTGATGCCCATCATGATCGGCGGCTTTGGAAACTGACTAATCCCTCTAATGATTGGGGCCCCCGATATGGCTTTCCCTCGAATAAATAATATGAGCTTCTGACTCCTCCCTCCCTCCTTTCTCCTTCTTCTTGCATCTTCAGGCGTTGAGGCCGGGGCTGGGACAGGTTGAACCGTTTACCCTCCTCTCGCCGGCAACCTGGCTCACGCAGGGGCATCCGTAGACCTAACGATCTTCTCCCTTCACCTAGCAGGGATTTCCTCTATTCTTGGAGCAATCAACTTTATTACCACAATCATTAACATGAAGCCCCCAGCTATCTCCCAGTACCAGACACCCCTATTCGTCTGAGCTGTCCTAGTCACCGCTGTCCTCCTTCTTCTATCACTCCCCGTCTTAGCTGCCGGAATCACAATGCTTCTCACGGATCGGAACCTTAATACAACATTCTTCGACCCAGCAGGGGGAGGAGACCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stomias boa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!