Overview

Comprehensive Description

Biology

Inhabits sand-bottomed and gravel-bottomed pools and runs of creeks and small rivers.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Ozarkian areas of Missouri, Arkansas, Oklahoma, and Kansas, in Red and Arkansas river drainages and independent tributaries of Mississippi River (Lee et al. 1980); locally common in northwestern part of range (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: in southern Missouri, eastern Kansas, Arkansas and northeastern Oklahoma, USA. Previously, 2 subspecies were recognized: Pimephales tenellus parviceps in the Castor, St. Francis, Black, White, lower Kansas, Ouachita and Little River systems; Pimephales tenellus tenellus in the Arkansas River drainage west of Arkansas-Oklahoma state line.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 70 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm TL (male/unsexed; (Ref. 5723))
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Pimephales tenellus
Catalog Number: USNM 143
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): H. Mollhausen
Year Collected: 1854
Locality: 20 miles west of Choctaw Agency, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Common in pools and quiet runs of creeks and small rivers over sandy, gravelly, or rocky bottoms. Schools in mid-water or near bottom. Spawns possibly in swift riffles.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pimephales tenellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCTGGGATAGTCGGAACCGCTTTAAGCCTTTTAATTCGAGCCGAACTAAGTCAACCCGGCTCACTTCTAGGTGACGACCAAATCTACAATGTTATTGTTACTGCTCACGCCTTTGTAATGATTTTCTTTATAGTAATGCCAATTCTAATTGGTGGGTTCGGAAACTGACTTGTACCTCTAATAATTGGAGCACCTGATATAGCATTTCCACGAATAAATAACATAAGCTTCTGACTTCTACCCCCATCATTCCTACTGCTGCTAGCCTCTTCTGGTGTTGAAGCCGGGGCCGGAACAGGATGAACTGTCTACCCCCCACTTGCCGGTAATCTTGCCCATGCAGGAGCATCAGTAGACCTCACAATTTTCTCTCTGCACTTAGCAGGTGTGTCATCAATTCTAGGGGCAGTTAATTTTATTACTACAATTATTAACATGAAACCCCCAGCAATCTCGCAATATCAAACACCTCTCTTTGTGTGAGCCGTACTTGTGACTGCCGTGCTTCTTCTCCTCTCACTACCCGTCCTAGCTGCCGGCATTACCATACTCCTAACTGATCGTAATTTAAATACTACATTCTTTGACCCAGCAGGAGGAGGGGACCCCATTCTCTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pimephales tenellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!