Overview

Comprehensive Description

Biology

Occurs almost anywhere in its range but most common in clear rocky streams (Ref. 3814, 10294); also inhabits large rivers, reservoirs and glacial lakes to the north. Feeds on algae, detritus, entomostraca, and immature insects, especially midge larvae and pupae (Ref. 10294).
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 Common and scientific names of fishes from the United States and Canada. Am. Fish. Soc. Spec. Pub. (20):183 p. (Ref. 3814)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The bluntnose minnow is widely distributed in small and medium-sized streams in North America. They occur from southern Quebec and Manitoba south to Louisiana, west to the Mississipi River drainage (but not the Mississippi River itself).(Froese and Pauly, 2002; State of Iowa DNR, 2001)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Mississippi River, Hudson Bay (Red River), and Great Lakes basins, from southern Quebec to southern Manitoba (Houston 2001) and south to Louisiana; Atlantic Slope from St. Lawrence River, Quebec, to Roanoke River, Virginia (absent from most of New England); Gulf Slope from Mobile Bay drainage, Alabama, to Mississippi River; abundant, probably the most common freshwater fish in eastern North America (Page and Burr 1991). Often transplanted as fish bait.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The bluntnose minnow is found only in the Nearctic region. They occur from southern Quebec and Manitoba south to Louisiana, west to the Mississipi River drainage (but not the Mississippi River itself).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Great Lakes, Hudson Bay (Red River) and Mississippi River basins from southern Quebec to southern Manitoba, Canada and south to Louisiana, USA; Atlantic Slope from St. Lawrence River in Quebec to Roanoke River in USA; Gulf Slope from Mobile Bay drainage in Alabama to Mississippi River, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

This is a very small silver fish, long and slender with a dark stripe from snout to tail. At the base of the tail the stripe becomes a dot. Upperparts are slightly olive while sides are bluish. The name "bluntnose" refers to the rather flat snout. During the breeding season, males become darker, with a silver bar behind the gill cover (opercle), and grow 16 bumps in three rows on their head. (Page and Burr 1991; State of Iowa DNR, 2001)

Range length: 11.0 (high) cm.

Other Physical Features: bilateral symmetry

Sexual Dimorphism: male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The bluntnose minnow is a very small silver fish, long and thin with a dark stripe from snout to tail. At the bottom of the tail the stripe becomes a dot. Upperparts are slightly olive while sides are bluish. The name "bluntnose" refers to the rather flat head and snout. During the breeding season, males become darker, with a silver bar behind the gill cover (opercle), and grow 16 bumps in three rows on their head.

Range length: 11.0 (high) cm.

Other Physical Features: bilateral symmetry

Sexual Dimorphism: male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 5 years (Ref. 12193)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Hyborhynchus superciliosus
Catalog Number: USNM 20532
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Collector(s): Cope ?
Locality: Kanawha R., West Virginia, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bluntnose minnows prefer clear, rocky streams and creeks that are small to medium in size. They also occur in natural and man-made lakes.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Lakes, ponds, rivers, and creeks in a variety of habitats. Most common in clear rocky streams. Schools in midwater or near bottom. Spawns in nest made by male under object on bottom on sandy or gravelly shoals, eggs attached to underside of cover.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bluntnose minnow is a freshwater fish that lives its entire life in the water. Bluntnose minnows prefer living in clear, rocky streams and creeks that are small to medium in size. They also occur in natural and man-made lakes.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bluntnose minnows eat algae, aquatic insect larvae, diatoms, and small crustaceans called entomostracans. Occasionally they will eat fish eggs or small fish. (State of Iowa DNR, 2001)

Primary Diet: carnivore (Eats eggs, Eats non-insect arthropods); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs almost anywhere in its range but most common in clear rocky streams.
  • Johnson, J.H. and D.S. Dropkin 1995 Diel feeding chronology of six fish species in the Juniata River, Pennsylvania. J. Freshwat. Ecol. 10(1):11-18. (Ref. 33056)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Bluntnose minnows eat algae, aquatic Insecta, diatoms, and small crustaceans called entomostracans. Occasionally they will eat Actinopterygii.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Bluntnose minnows serve an important role as prey for larger animals and as a predator on insect larvae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This small fish is prey to many larger fish as well as many birds and reptiles. To avoid them, minnows move fast, travel in schools, and hide.

A close relative, the fathead minnow (Pimephales notatus) gives off a chemical called "alarm substance" when under attack. Scientists think the substance may be a distress signal that attracts other predatory fish who interrupt the first predator, allowing the minnow to escape (Chivers et al., 1996)

The list below is only a sample of the species that eat minnows.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Bluntnose minnows serve an important role as prey for larger animals and as a predator on insect larvae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

This small fish is prey to many larger Actinopterygii as well as many Aves and Squamata. To avoid predators, minnows move fast, travel in groups called schools, or hide.

Like other minnows, these fish probably release a chemical called "alarm substance" when under attack. Scientists think the substance may be a distress signal that attracts other predatory Actinopterygii who may interrupt the first predator and allow the minnow to escape.

The list below is only a sample of the species that eat minnows.

Known Predators:

  • black-crowned night herons (Nycticorax_nycticorax)
  • great blue herons (Ardea_herodias)
  • belted kingfishers (Ceryle_alcyon)
  • ring-billed gulls (Larus_delawarensis)
  • common grackles (Quiscalus_quiscula)
  • northern pike (Esox_lucius)
  • largemouth bass (Micropterus_salmoides)
  • snapping turtles (Chelydra_serpentina)
  • painted turtles (Chrysemys_picta)
  • northern water snakes (Nerodia_sipedon)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pimephales notatus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

During breeding season the males use at least two methods of communication. First, their physical appearance changes (as described in the reproductive section). Second, males make a variety of pulsed sounds when acting aggresively with other males. It is not known if these sounds are also used in courtship or spawning.

Bluntnose minnows probably release chemicals called pheromones when they are alarmed.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

During breeding season the males use at least two methods of communication. First, their physical appearance changes (as described in the reproductive section). Second, males make a variety of pulsed sounds when acting aggresively with other males. It is not known if these sounds are also used in courtship or spawning.

Bluntnose minnows probably release chemicals called pheromones when they are alarmed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

A hole nester.
  • Balon, E.K. 1990 Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev. 1:1-48.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The maximimum recorded age for a bluntnose minnow is five years. It is unclear whether this was a captive or wild individual. (Froese and Pauly, 2002)

Range lifespan

Status: captivity:
5.0 (high) years.

Typical lifespan

Status: wild:
2.0 (high) years.

Average lifespan

Status: captivity:
5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The maximimum recorded age for a bluntnose minnow is five years, this was probably a captive individual. In the wild, two years is a more realistic lifespan.

Range lifespan

Status: captivity:
5.0 (high) years.

Typical lifespan

Status: wild:
2.0 (high) years.

Average lifespan

Status: captivity:
5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During the spawning season, males' heads grow darker and their bodies become bluish. They also develop three rows of bumps, or tubercles on their heads. Females release masses of eggs which stick to the underside of rocks or floating logs. They are therefore sheltered while spawning. Depending on the temperature of the waters, eggs may hatch into fry in 8 to 14 days. (State of Iowa DNR, 2002; USGS, 1982)

Breeding season: April through September, but usually May through July

Range gestation period: 14.0 (high) days.

Key Reproductive Features: fertilization (External ); oviparous

Males stay and guard the eggs and the fry. (USGS, 1982)

Parental Investment: male parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the spawning season, males' heads grow darker and their bodies become bluish. They also develop three rows of bumps (called tubercles) on their heads. Females release masses of eggs which stick to the underside of rocks or floating logs. The eggs are therefore protected while the male fertilizes them. Depending on the temperature of the waters, eggs may hatch into baby fish (called fry) in 8 to 14 days.

Breeding season: April through September, but usually May through July

Range time to hatching: 14.0 (high) days.

Key Reproductive Features: fertilization (External ); oviparous

The male fish take care of the eggs and guard them until they hatch.

Parental Investment: male parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pimephales notatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGAACCGCTTTAAGCCTCCTAATTCGAGCCGAACTAAGTCAACCAGGCTCACTTCTAGGTGACGACCAAATCTATAATGTTATTGTTACTGCTCACGCCTTTGTAATGATTTTCTTTATAGTAATGCCAATTCTAATTGGTGGGTTCGGAAACTGACTTGTACCTTTAATAATTGGAGCACCTGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTCTTACCCCCGTCATTCCTACTGCTACTAGCCTCTTCTGGTGTTGAAGCCGGGGCCGGAACAGGATGAACTGTTTACCCCCCACTTGCAGGTAACCTTGCCCATGCAGGAGCATCAGTAGACCTTACGATCTTCTCTCTGCATTTAGCAGGTGTGTCATCAATTCTAGGGGCAGTTAATTTTATTACTACAATTATTAATATGAAACCCCCAGCAATCTCACAGTATCAAACACCTCTCTTTGTGTGAGCCGTGCTTGTAACTGCCGTACTTCTACTCCTATCACTACCCGTTCTAGCTGCCGGCATTACTATGCTTCTAACTGATCGTAATTTAAATACCACATTCTTTGATCCAGCAGGAGGGGGAGATCCTATTCTCTATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pimephales notatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 126
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This is a very common fish. In fact, bluntnose minnows are probably the most abundant freshwater fish in the eastern United States. (Page and Burr, 1991)

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This is a very common fish. In fact, bluntnose minnows are probably the most abundant freshwater fish in the eastern United States.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Abundant where found in Ontario and Quebec, rare in Manitoba (Houston 2001).

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

This fish is commonly used for bait in the fishing industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Bluntnose minnows are commonly used for bait in the fishing industry. They are also used as a food source for raising larger sport fish, such as bass.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bluntnose minnow

"Bluntnose minnows" is also used for the genus Pimephales as a whole.

The bluntnose minnow (Pimephales notatus) is a species of temperate freshwater fish belonging to the Pimephales genus of the cyprinid family. Its natural geographic range extends from the Great Lakes south along the Mississippi River basin to Louisiana, and east across the Midwestern United States to New York State. The bluntnose is very ubiquitous, and may be the most common freshwater fish in the Eastern U.S.[1]

Description[edit]

Bluntnose minnows are commonly 6.5 cm (2.5 in) long, with a maximum length of 11 cm (4.3 in). On the first two or three dorsal rays are dark pigmented spots. The scales between the head and the dorsal fin are noted to be smaller than the rest of the scales on the body.[2] They have a rounded head and a terminal mouth, although the snout hangs a little bit over the mouth. The dark coloring on the edges of the scales cause a cross-hatched look along the body. The scales on these fish are cycloid scales, a type of leptoid scale. It is possible to find the age of a fish from the rings on the scales. The lateral line of a bluntnose minnow runs from its head to tail, ending in a black spot that makes them distinguishable from the fathead minnow.[3] These minnows have a pale olive upper body (above the lateral line) and a silvery lower body (below the lateral line), with silvery-blue scales near the lateral line.[4]

Distribution[edit]

The bluntnose minnow can be found in North America, in the Hudson Bay and Mississippi River basins from southern Quebec to southern Manitoba, Canada to Louisiana, USA. They are also found from the St. Laurence River in Quebec to the Roanoke River on the east coast of USA.[5] There are also many non-indigenous populations found in Connecticut, Georgia, Maryland, Massachusetts, New York, Ohio, South Dakota, Utah, Virginia, West Virginia, and Michigan, thought to have been introduced by bait bucket release or stock contamination.[6] Bluntnose minnows are thought to be the most abundant freshwater fish in the country.[7]

Habitat[edit]

Bluntnose minnows can be found in lakes, rivers, ponds and streams, showing a preference for shallow, clear water with a sandy bottom.[3] Their habitats range from headwater bogs, swamps, and springs to rivers, ponds, and lakes. Sometimes, up to a dozen species of minnows can be found in a single stream of moderate size. They can be found swimming in large groups or alone.[8]

Diet[edit]

These fish prefer to feed on aquatic insects, algae, diatoms, aquatic insect larvae, and small crustaceans called entomostracans. Occasionally they will eat fish eggs or small fish.[7]

Life cycle[edit]

Bluntnose minnows spawn from early spring to midsummer, depending on their habitat. They attach their eggs under stones in depressions they have dug.[8] During the mating season, the heads of the males will become darker and their bodies bluish. They also develop three rows of tubercles (bumps) on their heads. Eggs hatch in eight to fourteen days[7]

Etymology[edit]

The genus name Pimephales means fat head, the specific epithet notatus means marked or spotted.[2]

References[edit]

  1. ^ Page, Lawrence M. and Brooks M. Burr (1991), Freshwater Fishes, p. 129-130, Houghton Mifflin, New York, NY. ISBN 0-395-91091-9
  2. ^ a b "Bluntnose". Alabama Department of Conservation and Natural Resources. Retrieved 20 April 2012. 
  3. ^ a b "Bluntnose Minnow". Ohio Department of Natural Resources. 
  4. ^ Rook, Earl. "Pimephales notatus Bluntnose Minnow". Rook. Retrieved 19 April 2012. 
  5. ^ "Pimephales notatus Bluntnose minnow". Fish Base. Retrieved 19 April 2012. 
  6. ^ Leo Nico; Matt Neilson. "Pimephales notatus (Rafinesque 1820)". USGS. Retrieved 20 April 2012. 
  7. ^ a b c Parr, Cynthia Sims. "Bluntnose Minnow". University of Michigan. Retrieved 1 May 2012. 
  8. ^ a b "Minnow Family Cyprinidae". Cornell DNR. Retrieved 3 May 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Bluntnose minnow

"Bluntnose minnows" is also used for the genus Pimephales as a whole.

The bluntnose minnow, Pimephales notatus, is a species of temperate freshwater fish belonging to the Pimephales genus of the cyprinid family. The natural geographic range extends from the Great Lakes south along the Mississippi River basin to Louisiana, and east across the Midwestern United States to New York State. The bluntnose is very ubiquitous, and may be the most common freshwater fish in the Eastern U.S.[1]

References

  1. ^ Page, Lawrence M. and Brooks M. Burr (1991), Freshwater Fishes, p. 129-130, Houghton Mifflin, New York, NY. ISBN 0-395-91091-9
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!