Overview

Brief Summary

Biology

A fast and agile predator, the spinner shark preys on a variety of pelagic, bony fish including sardines, herrings, mullet and tunas, but will also take small sharks, cuttlefish, squids and octopi (1) (4). This species employs an unusual method of hunting, which involves swimming rapidly through schools of fish, spinning on its axis, and snapping in all directions at the scattering prey, culminating in an impressive leap from the water surface. Although high-up in the food chain, the spinner shark does occasionally fall prey to larger shark species, with the smaller juveniles and sub-adults being especially vulnerable (4). Populations of the spinner shark found in the Gulf of Mexico and off the coasts of Florida and Louisiana are known to be highly migratory, forming schools that move inshore during the spring and summer to reproduce and feed (4) (5). Like many shark species, the female spinner shark gives birth to live young (2) (4), producing between 3 and 15 well-developed offspring after a gestation period of around 12 to 15 months (4). The newborn sharks quickly move into shallow estuarine waters where sources of food are numerous and predation pressure is less intense (4). Despite the fearsome reputation of many large sharks, few are considered to be dangerous to humans. Only thirteen attacks have ever been recorded for this species, none of which have proven to be fatal (4). As with other shark species, the real cause for concern is the threat posed to the spinner shark by humans (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The spinner shark is a long, slender-bodied shark, so named for its habit of leaping from the water, when hooked or pursuing prey, and spinning in mid-air along the axis of its body (2) (3). This species has greyish-bronze upperparts fading to white on the underside, with a faint white band running along the sides. The fins are slender, with pointed or rounded tips. In some large juveniles and adults, distinctive black or grey tips may be found on the pelvic, dorsal and anal fins, as well as on the upper lobe of the caudal fin (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found on the continental and insular shelves from close inshore to offshore (Ref. 244). Makes vertical spinning leaps out of the water as a feeding technique in which the sharks spins through a school of small fish with an open mouth and then breaks the surface (Ref. 9997). Feeds mainly on pelagic bony fishes, also small sharks, cuttlefish, squids, and octopi (Ref. 244, 5578). Viviparous (Ref. 50449). Forms schools (Ref. 244). Highly migratory off Florida and Louisiana and in the Gulf of Mexico (Ref. 244). Regularly caught in fisheries where found (Ref. 244). Utilized fresh and dried salted for human consumption (Ref. 244). Fins probably used in the oriental shark fin trade, and livers for vitamin oil production (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Djibouti, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Madagascar, Mauritius, Mozambique, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: North Carolina, USA to northern Gulf of Mexico and the Bahamas, then from southern Brazil to northern Argentina. Reported from Cuba (Ref. 26340). Eastern Atlantic: Spain to Namibia, including the southern Mediterranean Sea. Indo-West Pacific: Red Sea south to South Africa and eastward to Indonesia, north to Japan, south to Australia. Often referred to as Carcharhinus limbatus in the past.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Spinner Shark is cosmopolitan in warm temperate, subtropical and tropical continental and insular shelf waters. It is known from off Cape Cod, Massachusetts (USA), to southern Brazil in the western Atlantic. It is found from the Mediterranean Sea southward to central Africa in the eastern Atlantic; the species is widespread in the Indian Ocean from South Africa to western Australia, including the Red Sea and Gulf of Oman; and in the western Pacific Ocean it is recorded from throughout the Indo-Australian Archipelago, the China Sea and the north and east coasts of Australia (Compagno in prep. b).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: North Carolina, USA to northern Gulf of Mexico and the Bahamas, then from southern Brazil to northern Argentina. Reported from Cuba
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea, Mascarenes, Red Sea), but except Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The spinner shark has a worldwide distribution, occurring in most of the world's major oceans, mainly within subtropical, coastal waters (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

300 cm TL (male/unsexed; (Ref. 26999)); max. published weight: 89.7 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A slender shark with a long, narrow, pointed snout, long gill slits and small, narrow-cusped teeth; first dorsal fin small; no interdorsal ridge; labial furrows longer than in any other grey shark (Ref. 5578). Grey above, white below, with a conspicuous white band on sides; second dorsal, anal, undersides of pectorals and lower caudal-fin lobe black or dark grey-tipped in subadults and adults, but unmarked or nearly so in small individuals (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found on the continental and insular shelves, ranging close inshore and offshore. Feeds on small fishes, cuttlefish, squid, and octopi. Viviparous (with a yolk-sac placenta); litters of 2 to 15 pups, 46 to 80 cm at birth. Forms schools. Highly migratory off Florida and Louisiana in the Gulf of Mexico. Utilized fresh and dried salted for human consumption. Also valuable for hides and fins, and liver for oil.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 0 - 100 m (Ref. 27000), usually 0 - ? m (Ref. 55179)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Spinner Shark is common in nearshore waters off beaches, in bays and off river mouths and also occurs pelagically offshore. It is common year round in southern areas of the United States and occasionally migrates north in the summer into the Middle Atlantic Bight.

This shark has an unusual habit of leaping from the water, rotating as many as three times and falling back in the water, usually on its back. Spinner Sharks are often found in schools that may include large numbers of individuals (Compagno in prep. b). The species has an 11?15 month gestation period and is placentally viviparous, producing 3?20 pups (usually 7?11). The reproductive cycle is two years (Castro 1993). In the western North Atlantic, ovulation occurs in late June and mating occurs in late June through early July; pups are born in late May?July at 60?75 cm total length (TL). In South Africa newborns of 60?80 cm TL have been reported, with parturition in April?May. Pregnant females have been caught in February?March in southeastern Australia, with parturition occurring in March?April; pup lengths of 66?77 cm TL are reported. Young are also born in the summer off the north-west coast of Africa and in the eastern Mediterranean and Red seas. The Spinner Shark uses nearshore beaches and bays, and higher saline portions of estuaries throughout the south-east United States as nursery grounds, but parturition probably takes place in waters deeper than 5 m.

Compared to many shark species, the Spinner Shark grows at a relatively fast rate, although only one growth study exists for this species, that addressing a north-west Atlantic population. Since other populations differ greatly in many life history characteristics and maximum sizes, the values reported here may not be applicable to those regions. For the northwest Atlantic, neonates born at 60?75 cm TL increase by as much as 30 cm in length by the onset of winter (circa six months). One-year olds continue to grow at about 25 cm/year, with the growth rate slowly declining to about 10 cm/year through adolescence. Males mature at ~130 cm TL, or at 4?5 years of age, females at 150?155 cm TL or 7?8 years of age. Maximum recorded age is 11 years (a 208 cm TL female) but the species attains a much larger size (225? 250 cm TL). Age at the largest known sizes (assuming a continued 5 cm annual growth) would be 15?20 years, although as the sharks get older, incremental growth should decline, thus age at maximum size may be substantially greater (Branstetter 1987a).

The species is primarily a fish-eater, with diet including 10-pounders (Elops), sardines and herring, anchovies, sea catfish, lizardfish, mullets, bluefish, tunas, bonito, croakers, jacks, mojarras, grunts, tongue-soles, stingrays, cuttlefish, squid and octopuses. It frequently uses an unusual method of feeding on schools of small, bony fishes that gives this shark its common name; it swims rapidly upwards through the schools with open mouth, spinning along its long axis and snapping in all directions, and then shoots out of the water after its feeding run. Off Madagascar this species is associated with and probably feeds on migrating schools of scombrids and jacks. As with C. limbatus, this shark will congregate to eat trash fish dumped off shrimp trawlers and no doubt participates in feeding frenzies like its smaller relative (Compagno in prep. b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 2 - 1482
  Temperature range (°C): 4.248 - 26.170
  Nitrate (umol/L): 1.057 - 29.210
  Salinity (PPS): 34.603 - 36.025
  Oxygen (ml/l): 2.877 - 4.917
  Phosphate (umol/l): 0.225 - 1.926
  Silicate (umol/l): 4.143 - 26.849

Graphical representation

Depth range (m): 2 - 1482

Temperature range (°C): 4.248 - 26.170

Nitrate (umol/L): 1.057 - 29.210

Salinity (PPS): 34.603 - 36.025

Oxygen (ml/l): 2.877 - 4.917

Phosphate (umol/l): 0.225 - 1.926

Silicate (umol/l): 4.143 - 26.849
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: benthopelagic. Spinner shark.  (Muller & Henle, 1839) Attains 2.7 m. A large slender bodied shark with a long pointed snout and small eyes. Overall body colour is grey or brownish-grey above and white below. Sometimes with a paler narrow band along each flank. The fins of specimens in excess of 1.3 metres are characteristically marked; the tips of both dorsals, pectorals, anal and lower caudal are distinctly black. There are some exceptions and occasional specimens lack the black tip to the first dorsal and upper pectoral fins. Juveniles are more difficult to identify as they have virtually no markings on their fins. This is a common shark of coastal waters and is the shark most commonly netted off Natal beaches by the Natal Sharks Board. This shark appears to prefer shallower waters and may venture into very shallow water. It has not been recorded in depths greater than 75 metres. This active predator preys on a variety of midwater shoaling fishes such as small tuna, mullet, kinfishes, sardines, kob and small sharks. Lizardfishes, squid and cuttlefish are also eaten. Most of the food is swallowed whole as this shark does not have the typical cutting teeth. Part of its feeding strategy involves dashing full-speed into a shoal of fish, breaking water, often spinning in the air and falling back to the surface. Adult females occur off the Natal coast throughout the year, but males are only common during summer. Sexual maturity occurs at about 180 cm. for males and 210 cm. for females. Gestation period is one year. The viviparous females produce litters of 6-15 young during autumn. Spinner sharks are about 60 cm. when born, and often move into shallow water off sandy beaches after birth. Young spinner sharks are known to undertake considerable migrations. This shark does not pose a major threat to bathers. Juvenile spinner sharks are caught by shore anglers and adults are caught in shark nets. Spinner sharks are edible; and the fins are suitable for sharkfin soup. A tropical shallow-water species of the Red Sea and all major oceans; extends southward to Mossel Bay in South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The spinner shark is generally found in subtropical inshore or nearshore waters, from shallow regions within bays, to depths of up to 100 metres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154). A carnivore (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, with a yolk-sac placenta; bears up to 20 young (Ref. 5578); 3-15 pups (Ref.58048). Size at birth 60 to 80 cm (Ref. 6871). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus brevipinna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTTATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGGGATGATCAGATCTACAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTCATGGTTATACCAATTATAATTGGTGGTTTCGGAAACTGACTAGTTCCCTTAATAATTGGTGCACCAGATATAGCCTTCCCACGGATAAATAACATAAGCTTCTGACTCCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTTTATCCTCCATTAGCTAGCAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATCTTAGCTTCAATTAATTTTATCACAACTATTATTAACATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTTTCACTTCCAGTCCTTGCAGCAGGGATTACAATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGACCCTGCAGGCGGAGGAGACCCAATCCTTTATCAACATTTATTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus brevipinna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 118
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Burgess, G.H.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Spinner Shark (Carcharhinus brevipinna) is an active, schooling species that often leaps spinning out of the water. This common coastal-pelagic warm-temperate and tropical shark frequently is captured in recreational and commercial fisheries. It is a species that frequents nearshore waters as adults and has inshore nursery areas, making it highly vulnerable to fishing pressure and human-induced habitat alteration.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1bd+2d

Version
2.3

Year Assessed
2000

Assessor/s
Burgess, G.H.

Reviewer/s
Musick, J.A. & Fowler, S. (Shark Red List Authority)

Justification
The spinner shark is cosmopolitan in near and offshore warm-temperate, subtropical and tropical continental and insular shelf waters. It is frequently captured in recreational and commercial fisheries. Its meat is valuable and fins are marketable. It frequents nearshore waters as adults and has inshore nursery areas, making it highly vulnerable to fishing pressure and human-induced habitat alteration.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List. North-west Atlantic subpopulation classified as Vulnerable (VU) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
In the northwest Atlantic this species is part of the recreational fishery and is one of a suite of carcharhinids targeted by the directed commercial fishery operating along the southeast coast from North Carolina to Florida and throughout the Gulf of Mexico. It is a common component of the commercial catch in the north-central Gulf of Mexico, but is less often caught in the fisheries along the eastern seaboard of the United States. As with most carcharhinid species, the Spinner Shark meat is sold under the name ?Blacktip Shark? because of wide consumer preference for the product. It is a constituent of the substantial Mexican Gulf of Mexico shark catch. Probably it is represented in the shark catches in most areas within its range, but owing to confusion with the Blacktip Shark, it is likely that the species is not recorded in landings data. Fins are dried and shipped to the Far East where they are used in shark fin soup. In some areas the hides are likely to be utilized in preparing leather and the livers are used to extract oil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Due to the fact that the spinner shark is a common, widespread species found in nearshore habitats, it suffers from heavy recreational and commercial fishing pressure, especially in the north-west Atlantic. The meat is used for human consumption, the liver for vitamin oil production, and the fins are likely to be sold in the oriental shark trade. This exploitation is compounded by the fact that the spinner shark's nursery grounds are found inshore. Therefore a large proportion of sharks caught may be pregnant females, while the estuary-dwelling pups may suffer significantly from the effects of human-induced habitat degradation (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

While there are no specific conservation measures targeting the spinner shark (1), several conservation organisations, such as the Save Our Seas Foundation, the Shark Research Institute, the Shark Trust, and Bite-back, are working diligently to eliminate unsustainable shark fishing practices (5) (6) (7) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spinner shark

The spinner shark (Carcharhinus brevipinna) is a species of requiem shark, family Carcharhinidae, named for the spinning leaps it makes as a part of its feeding strategy. This species occurs in tropical and warm temperate waters worldwide, except for in the eastern Pacific Ocean. It is found from coastal to offshore habitats to a depth of 100 m (330 ft), though it prefers shallow water. The spinner shark resembles a larger version of the blacktip shark (C. limbatus), with a slender body, long snout, and black-marked fins. This species can be distinguished from the blacktip shark by the first dorsal fin, which has a different shape and is placed further back, and by the black tip on the anal fin (in adults only). It attains a maximum length of 3 m (10 ft).

Spinner sharks are swift and gregarious predators that feed on a wide variety of small bony fishes and cephalopods. When feeding on schools of forage fish, they will speed vertically through the school while spinning on their axis, erupting from the water at the end. Like other members of its family, the spinner shark is viviparous, with females bearing litters of 3–20 young every other year. The newborns are born in shallow nursery areas near the coast, and are relatively fast-growing. This species is not usually dangerous to humans but may become belligerent when excited by food. Spinner sharks are valued by commercial fisheries across their range for their meat, fins, liver oil, and skin. They are also esteemed as strong fighters by recreational fishers. The International Union for Conservation of Nature (IUCN) has assessed this species as Near Threatened worldwide and Vulnerable off the southeastern United States.

Contents

Taxonomy and phylogeny [edit]

The spinner shark was originally described as Carcharias (Aprion) brevipinna by Johannes Peter Müller and Friedrich Gustav Jakob Henle in their 1839 Systematische Beschreibung der Plagiostomen, based on the mounted skin of a 79 cm (31 in) long specimen collected off Java.[2] This species was subsequently moved to the genera Aprion, Squalus, and Aprionodon before being placed within the genus Carcharhinus.[3] The tooth shape and coloration of this species varies significantly with age and between geographical regions, which caused much taxonomic confusion.[2] Other common names include blacktipped shark, great blacktip shark, inkytail shark, large blacktip shark, long-nose grey shark, longnose grey whaler, and smoothfang shark.[4]

Based on similarities in morphology, tooth shape, and behavior, the closest relatives of the spinner shark were originally believed to be the blacktip shark and the graceful shark (C. amblyrhynchoides).[5] However, this interpretation was not supported by Gavin Naylor's 1992 allozyme analysis, which suggested that these similarities are the product of convergent evolution and that the closest relative of the spinner shark is the copper shark (C. brachyurus).[6] In a 2007 ribosomal DNA study by Mine Dosay-Akbulut, the spinner shark was found to be the most genetically divergent of all the requiem shark species examined save for the tiger shark (Galeocerdo cuvier), being less related to other Carcharhinus species than the lemon shark (Negaprion brevirostris).[7]

Distribution and habitat [edit]

Some uncertainty exists in the distribution data for the spinner shark due to confusion with the blacktip shark. In the western Atlantic Ocean, it occurs from North Carolina to the northern Gulf of Mexico, including the Bahamas and Cuba, and from southern Brazil to Argentina. In the eastern Atlantic, it occurs from off North Africa to Namibia. In the Indian Ocean, it is found from South Africa and Madagascar, to the Red Sea and the Gulf of Aden, to India and nearby islands, to Java and Sumatra. In the Pacific Ocean it occurs off Japan, Vietnam, Australia, and possibly the Philippines.[2][3] Parasitological evidence suggests that Indian Ocean spinner sharks have passed through the Suez Canal into the Mediterranean Sea, becoming Lessepsian migrants.[8]

The spinner shark has been reported from ocean surface to a depth of 100 m (330 ft), though it prefers shallow water less than 30 m (100 ft) deep, and occupies all levels of the water column. This species may be found from coastal waters to well offshore, over continental and insular shelves. Juveniles have been known to enter bays but avoid brackish conditions. The northwest Atlantic subpopulation is known to be migratory; in spring and summer they are found in warm inshore waters, and in winter they move south into deeper water.[2][3]

Description [edit]

Drawing of a spinner shark and its tooth

The average spinner shark is 2 m (6.4 ft) long and weighs 56 kg (123 lbs); this species attains a maximum known length and weight of 3 m (10 ft) and 90 kg (198 lbs). Indo-Pacific sharks are generally larger than those from the northwest Atlantic.[3] This species has a slim, streamlined body with a distinctive long, pointed snout. The eyes are small and circular. There are prominent forward-pointing furrows at the corners of the mouth. The tooth rows number 15–18 in each half of the upper jaw and 14–17 in each half of the lower jaw, with 2 and 1 tiny symphysial (central) teeth respectively. The teeth have long, narrow central cusps and are finely serrated in the upper jaw and smooth in the lower jaw. The five pairs of gill slits are long.[2]

The first dorsal fin is relatively small and usually originates behind the free rear tip of the pectoral fins. There is no ridge between the first and second dorsal fins. The pectoral fins are moderately short, narrow, and falcate (sickle-shaped).[2] The body is densely covered with diamond-shaped dermal denticles with 7 (rarely 5) shallow horizontal ridges. The coloration is gray above, sometimes with a bronze sheen, and white below, with a faint white band on the sides. Young individuals have unmarked fins; the tips of the second dorsal fin, pectoral fins, anal fin, and lower caudal fin lobe (and sometimes the other fins as well) are black in larger individuals. The spinner shark differs from the blacktip shark in that its first dorsal fin is slightly more triangular in shape and is placed further back on the body. Adults can also be distinguished by the black tip on the anal fin.[2][3]

Biology and ecology [edit]

The spinner shark is a fast, active swimmer that sometimes forms large schools, segregated by age and sex. Young individuals prefer cooler water temperatures than adults.[9] Off South Africa, females are found close to shore year-round while males only appear during the summer.[10] Smaller spinner sharks may be preyed upon by larger sharks. Known parasites of the spinner shark include the copepods Kroyeria deetsi, Nemesis pilosus, and N. atlantica, which infest the shark's gills, Alebion carchariae, which infests the skin, Nesippus orientalis, which infests the mouth and gill arches, and Perissopus dentatus, which infests the nares and the rear margins of the fins.[3]

Feeding [edit]

Spinner sharks feed primarily on small bony fishes, including tenpounders, sardines, herring, anchovies, sea catfish, lizardfish, mullets, bluefish, tunas, bonito, croakers, jacks, mojarras, and tongue-soles. They have also been known to eat stingrays, cuttlefish, squid, and octopus.[2] Groups of spinner sharks are often found pursuing schools of prey at high speed.[11] Individual prey are seized and swallowed whole, as this shark lacks cutting dentition.[10] This species employs an unusual tactic when feeding on schools of small fish: the shark charges vertically through the school, spinning on its axis with its mouth open and snapping all around it. The shark's momentum at the end of these spiraling runs often carries it into the air, giving it its common name.[2][12] The blacktip shark also performs this behavior, though not as often.[3] Off Madagascar, spinner sharks follow migrating schools of mackerel, tunas, and jacks. Like blacktip sharks, they congregate around shrimp trawlers to feed on the discarded bycatch, and may be incited into feeding frenzies.[2]

Life history [edit]

Claspers (external male copulatory parts) of a young Carcharhinus brevipinna

Like other requiem sharks, the spinner shark is viviparous. Adult females have a single functional ovary and two functional uteruses; each uterus is divided into compartments, one for each embryo. The embryos are initially sustained by a yolk sac. When the embryo grows to around 19 cm (7.5 in) long, the supply of yolk has been exhausted and the empty yolk sac develops into a placental connection through which the mother provides nutrients for the remainder of gestation. This species has the smallest ova relative to the fully developed embryo of any viviparous shark known.[13] Females give birth to 3–20 (usually 7–11) pups every other year, after a gestation period of 11–15 months. Mating occurs from early spring to summer, and parturition in August off North Africa, from April to May off South Africa, and from March to April in the northwestern Atlantic.[13][14] Young are birthed in coastal nursery areas such as bays, beaches, and high-salinity estuaries in water deeper than 5 m (16 ft).[14]

The length at birth is 66–77 cm (26–30 in) in the northwestern Atlantic,[14] 61–69 cm (24–27 in) off Tunisia,[13] and 60 cm (24 in) off South Africa.[10] Spinner sharks are relatively fast-growing sharks: 30 cm (12 in) per year for newborns, 25 cm (10 in) per year for one-year-olds, 10 cm (4 in) per year for adolescents, and 5 cm (2 in) per year for adults. In the northwestern Atlantic, males mature at 1.3 m (4.3 ft) long and females at 1.5–1.6 m (4.9–5.2 ft) long, corresponding to ages of 4–5 years and 7–8 years respectively.[14] Off South Africa, males mature at 1.8 m (5.9 ft) and females at 2.1 m (6.9 ft).[10] Spinner sharks generally do not reproduce until they are 12–14 years old. The maximum lifespan has been estimated at 15–20 years or more.[14]

Human interactions [edit]

The spinner shark is valued by both commercial and recreational fisheries.

Ordinarily, spinner sharks do not pose a substantial danger to humans; they do not perceive large mammals as prey as their small, narrow teeth are adapted for grasping rather than cutting. However, they can become excited by the presence of food, and so caution is warranted if this species is encountered while spearfishing.[2] As of 2008, the International Shark Attack File listed 16 unprovoked attacks and 1 provoked attack attributable to the spinner shark, none of them fatal.[15]

The meat of the spinner shark is of high quality and sold fresh or dried and salted. In addition, the fins are used for shark fin soup in East Asia, the liver oil is processed for vitamins, and the skin is made into leather products. Spinner sharks are an important catch of the US commercial shark fisheries operating in the northwestern Atlantic and the Gulf of Mexico. The meat is marketed under the name "blacktip shark" in the United States, due to that species being considered superior in quality by consumers. It is likely also caught by other fisheries across its range, going unreported owing to confusion with the blacktip shark.[14] The spinner shark is also highly regarded by recreational fishers, being described as a "spectacular fighter" that often leaps out of the water.[16]

The International Union for Conservation of Nature (IUCN) has assessed the spinner shark as Near Threatened worldwide and Vulnerable in the northwest Atlantic; its frequent use of coastal habitats render it vulnerable to human exploitation and habitat degradation.[1] The Northwest Atlantic fishery for this species is managed under the US National Marine Fisheries Service (NMFS) 1999 Fishery Management Plan (FMP) for Atlantic Tunas, Swordfish and Sharks. For the purposes of commercial quotas and recreational bag limits, the spinner shark is categorized as a "Large Coastal Shark" (LCS).[14]

References [edit]

  1. ^ a b Burgess, G.H. (2000). Carcharhinus brevipinna. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved May 7, 2009.
  2. ^ a b c d e f g h i j k Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 466–468. ISBN 92-5-101384-5. 
  3. ^ a b c d e f g Bester, C. Biological Profiles: Spinner Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on May 7, 2009.
  4. ^ Froese, Rainer and Pauly, Daniel, eds. (2009). "Carcharhinus brevipinna" in FishBase. May 2009 version.
  5. ^ Garrick, J.A.F. (1982). "Sharks of the genus Carcharhinus". NOAA Technical Report, NMFS CIRC-445.
  6. ^ Naylor, G.J.P. (1992). "The phylogenetic relationships among requiem and hammerhead sharks: inferring phylogeny when thousands of equally most parsimonious trees result". Cladistics 8 (4): 295–318. doi:10.1111/j.1096-0031.1992.tb00073.x. 
  7. ^ Dosay-Akbulut, M. (2008). "The phylogenetic relationship within the genus Carcharhinus". Comptes Rendus Biologies 331 (7): 500–509. doi:10.1016/j.crvi.2008.04.001. PMID 18558373. 
  8. ^ Castri, F., Hansen, A.J. and Debussche, M. (1990). Biological Invasions in Europe and the Mediterranean Basin (second ed.). Springer. p. 300. ISBN 0-7923-0411-X. 
  9. ^ Compagno, L.J.V, Dando, M. and Fowler, S. (2005). Sharks of the World. Princeton University Press. pp. 293–294. ISBN 978-0-691-12071-3. 
  10. ^ a b c d Van der Elst, R. and Borchert, P. (1993). A Guide to the Common Sea Fishes of Southern Africa (third ed.). Struik. p. 36. ISBN 1-86825-394-5. 
  11. ^ Heemstra, E. (2004). Coastal Fishes of Southern Africa. NISC (PTY) LTD. p. 58. ISBN 1-920033-01-7. 
  12. ^ "Carcharhinus brevipinna, Spinner Shark". MarineBio.org. Retrieved May 9, 2009. 
  13. ^ a b c Capape, C., Hemida, F., Seck, A.A., Diatta, Y., Guelorget, O. and Zaouali, J. (2003). "Distribution and reproductive biology of the spinner shark, Carcharhinus brevipinna (Muller and Henle, 1841) (Chondrichthyes: Carcharhinidae)". Israel Journal of Zoology 49 (4): 269–286. doi:10.1560/DHHM-A68M-VKQH-CY9F. 
  14. ^ a b c d e f g Fowler, S.L., Cavanagh, R.D., Camhi, M., Burgess, G.H., Cailliet, G.M., Fordham, S.V., Simpfendorfer, C.A. and Musick, J.A. (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. pp. 106–109, 287–288. ISBN 2-8317-0700-5. 
  15. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on May 7, 2009.
  16. ^ Goldstein, R.J. (2000). Coastal Fishing in the Carolinas: From Surf, Pier, and Jetty (third ed.). John F. Blair. p. 129. ISBN 0-89587-195-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!