Overview

Comprehensive Description

Biology

Inhabits sand-gravel riffles and runs near debris and among tree roots along undercut banks in creeks to large rivers (Ref. 5723, 10294). Feeds on aquatic insect immatures dominated by mayflies, caddisflies, midges, and blackflies (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Lower and central Mississippi basin from northern Illinois to Louisiana, and from eastern Kentucky to central Kansas and Oklahoma; Gulf Slope drainages from Mobile Bay, Alabama, to Guadalupe River, Texas; locally common (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Mississippi River basin from northern Illinois to Louisiana, and from eastern Kentucky to central Kansas and Oklahoma in the USA; Gulf Slope drainages from Mobile Bay in Alabama to Guadalupe River in Texas, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Lower and central Mississippi basin from northern Illinois to Louisiana, and from eastern Kentucky to central Kansas and Oklahoma; Gulf Slope drainages from Mobile Bay, Alabama, to Guadalupe River, Texas; locally common (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central and southern U.S.A.: central Mississippi River basin and other rivers draining into the Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Lectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 36461
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph; Illustration; Radiograph
Collector(s): D. Jordan & C. Gilbert
Locality: Saline River, Benton, Arkansas, Arkansas, United States, North America
  • Lectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 201388
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Locality: Ark.: Salin River, Benton, Saline County, Arkansas, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 36426
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Washita River, At Arkadelphia, Ark., Arkansas, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 161731
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Ark.: Washita R., Arkadelphia, Arkansas, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 161730
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Poteau River At Slate Ford, Indian Territory, Some Distance West of the Village of Hackett City, Oklahoma, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 36383
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Poteau River At Slate Ford, Indian Territory, Some Distance West of the Village of Hackett City, Oklahoma, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Clear to moderately turbid streams (creeks to large rivers) having permanent flow and low to moderate gradient. Riffles, runs, and shallow pools near debris, over sandy, gravelly, or rocky bottom, or among tree roots along undercut banks. In Illinois most common over sand-gravel-silt-detritus. Nests have been found in beer cans in shaded narrow riffles with reduced flow (Burr and Mayden 1982).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 0.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Clear to moderately turbid streams (creeks to large rivers) having permanent flow and low to moderate gradient. Riffles, runs, and shallow pools near debris, over sandy, gravelly, or rocky bottom, or among tree roots along undercut banks. In Illinois most common over sand-gravel-silt-detritus. Nests have been found in beer cans in shaded narrow riffles with reduced flow (Burr and Mayden 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits sand-gravel riffles and runs near debris and among tree roots along undercut banks in creeks to large rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds throughout year; diet mainly larval mayflies, caddisflies, and chironomids (Burr and Mayden 1982). Also eats crustaceans and other madtom species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Mature oocytes recorded late May-July, nests with eggs in late June (water temperature 25 C). Eggs guarded by male. Males sexually mature at 2 years, some females by 1 year. Some live 54 months (Burr and Mayden 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Noturus nocturnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGGATAGTTGGCACTGCCCTTAGCCTGCTTATCCGGGCAGAGCTGGCTCAACCCGGAGCTCTCCTGGGCGACGATCAAATTTATAATGTAATTGTCACCGCCCATGCCTTTGTAATAATCTTCTTTATAGTAATACCAGTAATAATCGGGGGATTCGGCAATTGACTTGTACCCCTAATGATTGGGGCCCCGGACATAGCCTTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCTCCCTCCTTCCTACTACTCCTTGCCTCTTCAGGCGTCGAAGCTGGGGCCGGAACAGGATGAACTGTATACCCCCCCCTCGCCGGTAACCTTGCCCATGCAGGAGCCTCTGTAGATTTAACCATCTTCTCCCTCCACCTCGCAGGGGTCTCATCTATTCTGGGAGCCATTAATTTTATTACAACCATCATTAACATAAAACCCCCTGCAATCTCGCAATATCAAACCCCCTTGTTTGTGTGGGCCGTTCTAATTACAGCTGTTCTTCTACTTTTATCCCTCCCTGTACTAGCCGCCGGCATTACAATACTTTTAACAGACCGAAATCTAAATACCACATTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTCTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Noturus nocturnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Noturus nocturnus

The Freckled Madtom (Noturus nocturnus) is one of the 324 fish species found in Tennessee.

Introduction[edit]

Noturus nocturnus, commonly known as the freckled madtom, is a common fish in Tennessee and across the eastern United States, but a monitoring plan for this species is in order. More research on topics including the distribution, life history, and threats to survival of N. nocturnus is necessary in order for conservationists to best manage the survival of the species. This is important because N. nocturnus is likely an integral member of the habitats it occupies, and its conservation would probably be beneficial to other species, including other fish species as well as its predators. N. nocturnus' distribution in Tennessee is the western side of Tennessee, but it is also found in several states east of the Continental Divide. The species is a benthic feeder mostly of invertebrates and usually inhabits waters that are medium to large in size, living mostly in riffle areas that have mostly clear waters and rocky bottoms. Its spawning season occurs from spring to early summer in riffle areas, and sexual maturation occurs after a couple of years. Though N. nocturnus is not a federally listed threatened or endangered species, human-induced influences such as dams and water pollution as well as invasive species may contribute to small population sizes and limited distribution. Because of its lack of federal listing on endangered species lists, little is being done to improve the conservation of this species. A large-scale assessment spanning two or three years across the known distribution of N. nocturnus as well as in surrounding states and their waterways is needed.

Geographic Distribution of Species[edit]

Noturus nocturnus is a freshwater species found across the eastern side of the United States and is common across most of its range. This range includes the Mississippi basin and tributaries of the Gulf of Mexico in the states Alabama, Mississippi, Louisiana, and Texas. This species is also found in the lower Ohio basin in Kentucky, Indiana, and Illinois.[1][2] Other areas it is found include Oklahoma, southeastern Iowa, central Kansas, Arkansas, Georgia, and western Tennessee.[2][3][4] Latitudinally it is found mostly between 41°N to 30°N.[5] This range has been identified since at least 1980; the current distribution is similar to the historical one, though some small extensions have been driven north, possibly as a result of global warming.[6] This species is not known to travel often, especially over long distances.[7] Further, its distribution is not entirely known due to its small population sizes and ability to be easily misidentified. N. nocturnus individuals are often misidentified as bullheads or other catfishes.[3] Further, N. nocturnus is said to be an intolerant species that sometimes disappears after a disturbance. These individuals are fluvial specialists, meaning they are specialized to a particular habitat, theirs being fast-moving riffle habitats.[2] Human litter may be a potential disturbance to the species, as young as well as breeding adult male individuals have often been found in beverage cans and other human-created debris.[3] It may be difficult to determine range expansion, though, because of its small population sizes in certain areas, including central Oklahoma.[8] However, more recent studies have suggested that N. noturnus distributions have extended slightly as water quality in certain regions improves.[3]

Ecology[edit]

Noturus nocturnus is known to inhabit fast-moving and permanently moving streams that are medium to large in size. The streams usually contain rocky bottoms. Further, this species is sometimes found in the vicinity of undercut banks near masses of sticks and roots.[1] N. noturnus is an invertivore mostly, feeding on invertebrates. It uses ambush tactics in benthic regions largely at night in order to feed. It notably consumes insect larvae, including mayfly, black fly, caddisfly and midge larvae.[1] It will also occasionally eat crustaceans.[3] Though it is largely an invertivore, it has also been known to occasionally engage in piscivory, eating other fish. In the southern part of Mississippi, evidence was found of N. noturnus feeding on the smaller species N. leptacanthus. To aid in devouring victims, this catfish has a venom glands along smooth spines on the pectoral and dorsal fins.[9][10] Some human-induced changes may be affecting the abundances and distributions of this species. Though not the same species, another madtom, N. placidus has been shown to have lower abundances immediately upstream and downstream of dams, including lowhead dams, not just large ones.[11] N. placidus has also been shown to have lower abundances when cadmium, lead, and zinc have been found at high levels in the water, the levels of which are attributed to anthropogenic mining for these minerals.[12] Further, invasive species have been shown to pose risks to madtoms. The round goby, Neogobius melanostomus, invaded the Great Lakes in 1990 and have affected several fish species there. Although N. nocturnus is not found in this area of the United States, other Noturus spp. live in this region and have been impacted by the round goby. This goby has been shown to both compete and prey on Noturus spp.[13] Therefore, Noturus nocturnus may be susceptible to both human-induced influences as well as invasive species (which may have also been human-induced).

Life History[edit]

The maximum reported size of N. nocturnus is 15 centimeters, though it usually between 5 to 13.5 cm long and on average 4.6 cm.[5][14][15] The maximum age reported is 4 to 4.5 years.[7][14] Males become sexually mature by 2 years, most females by their second summer if not sooner, and polygamy is common among this species as well as other Noturus species.[7][16] Females produce an average of around 100 eggs per summer.[16] The oocytes mature by late May to early July, and males guard the nests usually by late June. Optimal water temperature surrounding the nests is 25°C.[7] Nests have been found under flat rocks, though still in the same fast-moving riffle areas this species inhabits.[15] Potential human-induced influences on its life history include human-created climate change, which may affect the birth and survival of this species.

Current Management[edit]

Nationally, N. nocturnus is not considered an endangered species and is not found on IUCN's (International Union for Conservation of Nature's) endangered species lists. However, in some areas it may be endangered. For example, it has been listed as an endangered species in Iowa since 1984,[17][18] though it is not entirely clear why this is so. The species was not found in Iowa until that same year (1984), and it was only found in small numbers. Normally the species is found much further south, so it is hypothesized that global warming may contribute to its range expansion north[6] Because the species is not listed as endangered nationally, however, little is being done to protect this species. There are no agencies devoted to protecting it because it is either being overlooked, misidentified, and/or not considered threatened. However, as previously discussed, anthropogenic activities such as damming and mining may contribute to lower abundances of Noturus spp.[11][12] and, therefore, probably N. nocturnus itself. Invasive species may also negatively affect Noturus species abundances.[13] Therefore, management may be lacking. Furthermore, because it is hard to identify, N. nocturnus may be being more threatened that is currently suspected, so the current, lacking management may need to be improved. Less damming and mining and better control over invasive species is likely needed for the survival and success of this species.

References[edit]

  1. ^ a b c Bonner, T., “Noturus nocturnus: Freckled Madtom.” Texas State Department of Biology. http://www.bio.txstate.edu/~tbonner/txfishes/noturus%20nocturnus.htm
  2. ^ a b c Page, L.M., “Freckled Madtom: Noturus nocturnus.” Florida Museum of Natural History. http://www.flmnh.ufl.edu/catfish/ictaluridae/freckledmadtom.htm
  3. ^ a b c d e Willink, P.W., F.M. Veraldi, and J.B. Ladonski, “Rediscovery of the Freckled Madtom Noturus nocturnus Jordan & Gilbert in the Des Plaines River, Illinois.” Transactions of the Illinois State Academy of Science 99 (2006).
  4. ^ U.S. Geological Survey, “Noturus nocturnus Jordan and Gilbert, 1886.” U.S. Department of the Interior. http://nas.er.usgs.gov/queries/factsheet.aspx?SpeciesID=2536
  5. ^ a b FishBase, “Noturus nocturnus Jordan & Gilbert, 1886: Freckled Madtom.” FishBase. http://www.fishbase.org/summary/Noturus-nocturnus.html
  6. ^ a b Bernstein, N.P. and Olson, J.R., “Ecological Problems with Iowa’s Invasive and Introduced Fishes.” Journal of the Iowa Academy of Science 108 (2001): 185-209.
  7. ^ a b c d NatureServe, “Noturus nocturnus - Jordan and Gilbert: Freckled Madtom.” NatureServe Explorer. http://www.tnfish.org/SpeciesFishInformation_TWRA/Research/FreckledMadtomNoturusNocturnus_NatureServeExplorer.pdf
  8. ^ Orth, D.J. and Jones, R.N. “Range Extensions of the Orangethroat Darter (Etheostoma spectabile) and the Freckled Madtom (Noturus nocturnus) into Western Oklahoma.” Proceedings of the Oklahoma Academy of Science 60 (1980): 98-99.
  9. ^ Egge, J.J.D. and Simons, A.M., “Evolution of Venom Delivery Structures in Madtom Catfishes (Siluriformes: Ictaluridae).” Biological Journal of the Linnean Society 102 (2011): 115-129.
  10. ^ Wright, J.J., “Diversity, Phylogenetic Distribution, and Origins of Venomous Catfishes.” BMC Evolutionary Biology 9 (2009): 1-12.
  11. ^ a b Tiemann, J.S. et al., “Effects of Lowhead Dams on Riffle-Dwelling Fishes and Macroinvertebrates in a Midwestern River.” Transactions of the American Fisheries Society 133 (2004): 705-717.
  12. ^ a b Wildhaber, M.L., “Natural and Anthropogenic Influences on the Distribution of the Threatened Neosho Madtom in a Midwestern Warmwater Stream.” Transactions of the American Fisheries Society 129 (2000): 243-261.
  13. ^ a b Poos, M. et al., “Secondary Invasion of the Round Goby into High Diversity Great Lakes Tributaries and Species at Risk Hotspots: Potential New Concerns for Endangered Freshwater Species.” Biological Invasions 12 (2010): 1269-1284.
  14. ^ a b Encyclopedia of Life, “Noturus nocturnus: Freckled Madtom.” Encyclopedia of Life. http://eol.org/pages/208076/details
  15. ^ a b Outdoor Alabama, “Freckled Madtom.” Alabama Department of Conservation and Natural Resources. http://www.outdooralabama.com/fishing/freshwater/fish/other/madtom/freckled/
  16. ^ a b Kinney, O. “Freckled Madtom (Noturus nocturnus).” Darlington School. http://www.darlingtonschool.org/faculty/okinney/Natural%20History/Fish/Student%20fish/freckled_madtom.htm
  17. ^ Iowa Department of Natural Resources, “Chapter 77: Endangered and Threatened Plant and Animal Species.” The Natural Resource Commission. http://www.iowadnr.gov/Environment/ThreatenedEndangered.aspx
  18. ^ Iowa Fish Atlas, “Freckled Madtom – Noturus nocturnus.” Iowa State University. http://maps.gis.iastate.edu/iris/fishatlas/IA164005.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Grady and LeGrande (1992) for a study of phylogenetic relationships, modes of speciation, and historical biogeography of Noturus madtom catfishes. See Lundberg (1992) for a synthesis of recent work on the systematic relationships of ictalurid catfishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!