Overview

Comprehensive Description

Biology

Inhabits sand-gravel riffles and runs near debris and among tree roots along undercut banks in creeks to large rivers (Ref. 5723, 10294). Feeds on aquatic insect immatures dominated by mayflies, caddisflies, midges, and blackflies (Ref. 10294).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Lower and central Mississippi basin from northern Illinois to Louisiana, and from eastern Kentucky to central Kansas and Oklahoma; Gulf Slope drainages from Mobile Bay, Alabama, to Guadalupe River, Texas; locally common (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Mississippi River basin from northern Illinois to Louisiana, and from eastern Kentucky to central Kansas and Oklahoma in the USA; Gulf Slope drainages from Mobile Bay in Alabama to Guadalupe River in Texas, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central and southern U.S.A.: central Mississippi River basin and other rivers draining into the Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 161731
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Washita River, Arkadelphia, Arkansas, Arkansas, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 36426
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Washita River, Arkadelphia, Arkansas, Arkansas, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 36461
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph; Illustration; Radiograph
Collector(s): D. Jordan & C. Gilbert
Locality: Saline River, Benton, Arkansas, Arkansas, United States, North America
  • Lectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 201388
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Locality: Ark.: Salin River, Benton, Saline County, Arkansas, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 161730
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Poteau River At Slate Ford, Indian Territory, Some Distance West of the Village of Hackett City, Oklahoma, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Noturus nocturnus Taylor
Catalog Number: USNM 36383
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1884
Locality: Poteau River At Slate Ford, Indian Territory, Some Distance West of the Village of Hackett City, Oklahoma, United States, North America
  • Paralectotype: Taylor, W. R. 1969. Bulletin of the United States National Museum. No. 282: 76, 79, 21.; Syntype: Jordan, D. S. & Gilbert, C. H. 1886. Proceedings of the United States National Museum. 9 (549): 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Clear to moderately turbid streams (creeks to large rivers) having permanent flow and low to moderate gradient. Riffles, runs, and shallow pools near debris, over sandy, gravelly, or rocky bottom, or among tree roots along undercut banks. In Illinois most common over sand-gravel-silt-detritus. Nests have been found in beer cans in shaded narrow riffles with reduced flow (Burr and Mayden 1982).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 0.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits sand-gravel riffles and runs near debris and among tree roots along undercut banks in creeks to large rivers.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Noturus nocturnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGGATAGTTGGCACTGCCCTTAGCCTGCTTATCCGGGCAGAGCTGGCTCAACCCGGAGCTCTCCTGGGCGACGATCAAATTTATAATGTAATTGTCACCGCCCATGCCTTTGTAATAATCTTCTTTATAGTAATACCAGTAATAATCGGGGGATTCGGCAATTGACTTGTACCCCTAATGATTGGGGCCCCGGACATAGCCTTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCTCCCTCCTTCCTACTACTCCTTGCCTCTTCAGGCGTCGAAGCTGGGGCCGGAACAGGATGAACTGTATACCCCCCCCTCGCCGGTAACCTTGCCCATGCAGGAGCCTCTGTAGATTTAACCATCTTCTCCCTCCACCTCGCAGGGGTCTCATCTATTCTGGGAGCCATTAATTTTATTACAACCATCATTAACATAAAACCCCCTGCAATCTCGCAATATCAAACCCCCTTGTTTGTGTGGGCCGTTCTAATTACAGCTGTTCTTCTACTTTTATCCCTCCCTGTACTAGCCGCCGGCATTACAATACTTTTAACAGACCGAAATCTAAATACCACATTCTTCGACCCCGCCGGAGGAGGGGACCCCATCCTCTACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Noturus nocturnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Freckled madtom

The freckled madtom (Noturus nocturnus) a species of freshwater madtom (catfish) found in the eastern United States. The freckled madtom is a benthic feeder mostly of invertebrates and usually inhabits waters that are medium to large in size, living mostly in riffle areas that have mostly clear waters and rocky bottoms. Its spawning season occurs from spring to early summer in riffle areas, and sexual maturation occurs after a couple of years.

Geographic distribution[edit]

The freckled madtom is a freshwater species found across the eastern United States; it is common across most of its range. This range includes the Mississippi River basin and tributaries of the Gulf of Mexico in Alabama, Mississippi, Louisiana, and Texas. This species is also found in the lower Ohio River basin in Kentucky, Indiana, and Illinois.[1][2] Other areas it is found include Oklahoma, southeastern Iowa, central Kansas, Arkansas, Georgia, and western Tennessee.[2][3][4] Latitudinally it is found mostly between 41°N to 30°N.[5] This range has been identified since at least 1980; the current distribution is similar to the historical one, though some small extensions have been driven north, possibly as a result of global warming.[6] This species is not known to travel often, especially over long distances.[7] Further, its distribution is not entirely known due to its small population sizes and ability to be easily misidentified. Freckled madtoms are often misidentified as bullheads or other catfishes.[3]

Further, the freckled madtom is said to be an intolerant species that sometimes disappears after a disturbance. These individuals are fluvial specialists, meaning they are specialized to a particular habitat, theirs being fast-moving riffle habitats.[2] Human litter may be a potential disturbance to the species; young as well as breeding adult male individuals have often been found in beverage cans and other human-created debris.[3] It may be difficult to determine range expansion, though, because of its small population sizes in certain areas, including central Oklahoma.[8] However, more recent studies have suggested that freckled madtom distributions have extended slightly as water quality in certain regions has improved.[3]

Ecology[edit]

The freckled madtom is known to inhabit fast-moving and permanently moving streams that are medium to large in size. The streams usually contain rocky bottoms. Further, this species is sometimes found in the vicinity of undercut banks near masses of sticks and roots.[1]

The freckled madtom is primarily an invertivore (feeding on invertebrates). It uses ambush tactics in benthic regions largely at night in order to feed. It notably consumes insect larvae, including mayfly, black fly, caddisfly and midge larvae.[1] It will also occasionally eat crustaceans.[3] Though it is largely an invertivore, it has also been known to occasionally engage in piscivory, eating other fish. In the southern part of Mississippi, evidence was found of freckled madtoms feeding on the smaller speckled madtom (N. leptacanthus). To aid in devouring victims, this catfish has a venom glands along smooth spines on the pectoral and dorsal fins.[9][10]

Life history[edit]

The maximum reported size of the freckled madtom is 15 centimetres (5.9 in). One source lists the average size as 4.6 centimeters (1.8 in), and another source lists an average size range of between 5 and 13.5 centimeters (2.0 and 5.3 in) long.[5][11][12]

The maximum age reported is 4 to 4.5 years.[7][11] Males become sexually mature by 2 years, most females by their second summer if not sooner, and polygamy is common among this species as well as other Noturus species.[7][13] Females produce an average of around 100 eggs per summer.[13] The oocytes mature by late May to early July, and males guard the nests usually by late June. Optimal water temperature surrounding the nests is 25 °C (77 °F).[7] Nests have been found under flat rocks, though still in the same fast-moving riffle areas this species inhabits.[12]

Conservation and management[edit]

The freckled madtom is not considered an endangered species at the federal level, and it is not found on the International Union for Conservation of Nature's endangered species lists. However, it has been listed as an endangered species in Iowa since 1984.[14][15]

References[edit]

  1. ^ a b c Bonner, T., "Noturus nocturnus: Freckled Madtom." Texas State Department of Biology. http://www.bio.txstate.edu/~tbonner/txfishes/noturus%20nocturnus.htm
  2. ^ a b c Page, L.M., "Freckled Madtom: Noturus nocturnus." Florida Museum of Natural History. http://www.flmnh.ufl.edu/catfish/ictaluridae/freckledmadtom.htm
  3. ^ U.S. Geological Survey, "Noturus nocturnus Jordan and Gilbert, 1886." U.S. Department of the Interior. http://nas.er.usgs.gov/queries/factsheet.aspx?SpeciesID=2536
  4. ^ a b FishBase, "Noturus nocturnus Jordan & Gilbert, 1886: Freckled Madtom." FishBase. http://www.fishbase.org/summary/Noturus-nocturnus.html
  5. ^ Bernstein, N.P. and Olson, J.R., "Ecological Problems with Iowa's Invasive and Introduced Fishes." Journal of the Iowa Academy of Science 108 (2001): 185-209.
  6. ^ a b c d NatureServe, "Noturus nocturnus - Jordan and Gilbert: Freckled Madtom." NatureServe Explorer. http://www.tnfish.org/SpeciesFishInformation_TWRA/Research/FreckledMadtomNoturusNocturnus_NatureServeExplorer.pdf
  7. ^ Orth, D.J. and Jones, R.N. "Range Extensions of the Orangethroat Darter (Etheostoma spectabile) and the Freckled Madtom (Noturus nocturnus) into Western Oklahoma." Proceedings of the Oklahoma Academy of Science 60 (1980): 98-99.
  8. ^ Egge, J.J.D. and Simons, A.M., "Evolution of Venom Delivery Structures in Madtom Catfishes (Siluriformes: Ictaluridae)." Biological Journal of the Linnean Society 102 (2011): 115-129.
  9. ^ Wright, J.J., "Diversity, Phylogenetic Distribution, and Origins of Venomous Catfishes." BMC Evolutionary Biology 9 (2009): 1-12.
  10. ^ a b Encyclopedia of Life, "Noturus nocturnus: Freckled Madtom." Encyclopedia of Life. http://eol.org/pages/208076/details
  11. ^ a b Outdoor Alabama, "Freckled Madtom". Alabama Department of Conservation and Natural Resources.
  12. ^ a b Kinney, O. "Freckled Madtom (Noturus nocturnus)." Darlington School. http://www.darlingtonschool.org/faculty/okinney/Natural%20History/Fish/Student%20fish/freckled_madtom.htm
  13. ^ Iowa Department of Natural Resources, "Chapter 77: Endangered and Threatened Plant and Animal Species." The Natural Resource Commission. http://www.iowadnr.gov/Environment/ThreatenedEndangered.aspx
  14. ^ Iowa Fish Atlas, "Freckled Madtom – Noturus nocturnus." Iowa State University. http://maps.gis.iastate.edu/iris/fishatlas/IA164005.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!