Overview

Comprehensive Description

Biology

Inhabits rocky and sandy pools and runs of creeks and small to medium rivers. Occasionally found in headwaters and large rivers.
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 Common and scientific names of fishes from the United States and Canada. Am. Fish. Soc. Spec. Pub. (20):183 p. (Ref. 3814)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Range includes the Atlantic slope of North America from Peedee River drainage, South Carolina, north to lower Hudson River drainage, New York, with isolated records in the Lake Ontario drainage, New York (Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range includes the Atlantic slope of North America from Peedee River drainage, South Carolina, north to lower Hudson River drainage, New York, with isolated records in the Lake Ontario drainage, New York (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic Slope from Hudson River drainage in New York to Peedee River drainage in North Carolina; Lake Ontario drainage in New York, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 9 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat includes rocky and sandy runs (less often pools) of creeks and small to medium rivers, usually near riffles (Page and Burr 2011). Occasionally this species is found in headwaters and tidal portions of some large rivers. Eggs are attached to branches, stumps, logs, cracks in rocks; in crevices under loose submerged bark, between exposed tree roots, or under flat rocks.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes rocky and sandy runs (less often pools) of creeks and small to medium rivers, usually near riffles (Page and Burr 2011). Occasionally this species is found in headwaters and tidal portions of some large rivers. Eggs are attached to branches, stumps, logs, cracks in rocks; in crevices under loose submerged bark, between exposed tree roots, or under flat rocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.65 - 0.65
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits rocky and sandy pools and runs of creeks and small to medium rivers. Occasionally found in headwaters and large rivers (Ref. 3814).
  • Flemer, D.A. and W.S. Woolcott 1966 Food habits and distribution of the fishes of Tuckahoe Creek, Virginia, with special emphasis on the bluegill, Lepomis m. macrochirus Rafinesque. Chesapeake Sci. 7(2):75-89. (Ref. 50685)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly insects, especially Diptera and Ephemeroptera.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but very large. This species is common in much of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in late spring and summer in north (May to late August in Maryland, late May to early July in Pennsylvania); individuals may spawn several times in a season. Male guards nest territory. Eggs hatch in 6-8 days at 20-25 C, or within 11 days at 20-20.5 C. Larvae inactive for about 6 days after hatching. Sexually mature at age 1 or 2, lives 3-4 years. Produces vocalizations used in species and sex recognition.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella analostana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATGGTGGGAACCGCTTTAAGCCTCCTTATTCGAGCTGAGTTAAGCCAACCTGGCTCACTTCTAGGTGACGACCAGATCTATAATGTTATTGTTACTGCTCATGCCTTTGTAATGATTTTCTTTATAGTAATACCAATTCTTATTGGTGGATTCGGAAATTGACTTGTACCTCTAATGATTGGGGCACCTGATATAGCATTTCCACGAATAAATAATATAAGCTTCTGACTCTTACCGCCATCATTCCTATTACTTCTGGCCTCCTCTGGTGTTGAAGCTGGGGCTGGAACAGGATGAACTGTATATCCCCCACTTGCAGGTAATCTTGCACACGCAGGAGCATCGGTAGACCTCACAATTTTCTCTCTCCACCTAGCAGGTGTATCTTCAATTCTAGGCGCAGTTAATTTCATCACTACAATTATTAACATGAAACCCCCAGCAATCTCTCAATATCAAACACCTCTCTTCGTATGGGCCGTACTTGTAACTGCTGTCCTCCTACTCCTCTCACTACCCGTTCTAGCTGCTGGAATTACTATACTTCTAACTGACCGTAACTTAAACACTACATTCTTTGACCCGGCAGGAGGAGGTGACCCTATTCTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella analostana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large. This species is common in much of its range.

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Satinfin shiner

The satinfin shiner (Cyprinella analostana) is a species of fish in the family Cyprinidae, the carps and minnows. It is native to the eastern United States, where its distribution extends from New York to South Carolina. It is a common fish and not considered threatened.[1]

This fish is about 7[2] to 9 centimeters long,[1] with a maximum length of 11 centimeters.[2]

It is a freshwater fish that inhabits rivers and creeks, sometimes entering pools and riffles, and found from headwaters to areas near tidal influence. It eats insects, especially flies and mayflies. Spawning occurs in spring and summer, with individuals spawning several times over a season. The eggs are laid in cracks and crevices, under rocks, and on tree roots and wood debris. The male guards them until the young emerge in about one to two weeks, depending on temperature. The lifespan of the species is 3 to 4 years.[1]

This species produces vocalizations that aid in species and sex recognition.[1]

References[edit]

  1. ^ a b c d Cyprinella analostana. NatureServe. 2013.
  2. ^ a b Froese, R. and D. Pauly. Cyprinella analostana. FishBase. 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus NOTROPIS and placed in genus (formerly subgenus) CYPRINELLA by Mayden (1989); this change was adopted in the 1991 AFS checklist (Robins et al. 1991). C. CHLORISTIA was regarded by Gibbs (1963) as a subspecies of C. ANALOSTANA, but Robins et al. (1991) and Mayden (1989) disagreed and retained the two as separate species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!