Articles on this page are available in 2 other languages: Spanish (2), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occur in midwater, usually below 400 m and occasionally in shallow water in the northern part of its range. Feed on crustaceans while swimming with its mouth open (Ref. 5377). Mesopelagic (Ref. 58302) and bathypelagic (Ref. 58426). Oviparous, with planktonic leptocephali (Ref. 32364). Degenerative changes in males and females suggest semelparity (Ref. 32364). Minimum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Nemichthys scolopaceus has an extremely elongate body that can reach up to 1.3 m in length. The body ends in a long narrow filament. Its jaws form a long and narrow snout with small teeth, although females have a very short snout. The dorsal, caudal and anal fins are joined together. Nemichthys scolopaceus can be recognised by its more or less pigmented dark brown body and its numerous fine teeth. The anal fin and tips of the pectoral fins are almost black in colour.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Banquereau Bank to the Caribbean Sea
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worldwide in tropical and temperate seas. Western Atlantic: Nova Scotia, Canada and northern Gulf of Mexico to Brazil. Eastern Atlantic: Spain to South Africa, including western Mediterranean (Ref. 3247); reported from Iceland (Ref. 12462). Regularly found in the Skagerrak (Ref. 35387). Northwest Pacific: Japan (Ref. 6885) and Arafura Sea (Ref. 9819). Eastern Pacific: Alaska (Ref. 6885) to Chile (Ref. 9068), including the Gulf of California (Ref. 32364).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worldwide in tropical and temperate seas, including Mediterranean Sea, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: in deep water, also in the South Atlantic. Eastern Atlantic: found near the Azores, near Madeira, off the Cape Verde Island, off West Africa; Pacific: off of New Guinea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

130 cm TL (male/unsexed; (Ref. 35388))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 130.0 cm TL (male/unsexed).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Jaws long (Ref. 13608). Posterior end of body narrow, ending as a long filament (Ref. 13608). Dorsal fin with about 350 rays; caudal fin not recognizable; anal fin with about 320 (Ref. 6885). Dark brown or grey in color, often darker below (Ref. 3248); anal fin and tips of pectoral fins almost black (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Nemichthys scolopaceus
Catalog Number: USNM 51589
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): United States Fish Commission (USFC)
Year Collected: 1902
Locality: Vicinity of Modu Manu, or Bird Island, Center of Bird Island, S. 32 degrees, W. 12.8 miles [nautical]., Nihoa, Northwestern Hawaiian Islands, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 572 to 1593
Vessel: Albatross
  • Type: Gilbert, C. H. 1905. Bulletin of the United States Fish Commission. 23 (for 1903): 587, fig. 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Nemichthys scolopaceus
Catalog Number: USNM 153591
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1891
Locality: Off Panama, Panama, Pacific
Depth (m): 838
Vessel: Albatross
  • Lectotype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 69.; Garman, S. 1899. Memoirs of the Museum of Comparative Zoology at Harvard College. 24: 324.; Syntype: Nielsen, J. G. & Smith, D. G. 1978. Dana Report. No. 88: 69.; Garman, S. 1899. Memoirs of the Museum of Comparative Zoology at Harvard College. 24: 324.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Nemichthys scolopaceus
Catalog Number: USNM 201410
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1967
Locality: Off Coast of Madeira, Madeira Islands, Atlantic
Depth (m): 1000
  • Paratype: Kanazawa, R. H. & Maul, G. E. 1967. Bocagiana. (No. 12): 3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Nemichthys scolopaceus
Catalog Number: USNM 27399
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Harbor At Port Gamble, Washington, Washington, United States, Pacific
  • Type: Jordan, D. S. & Gilbert, C. H. 1881. Proceedings of the United States National Museum. 3 (170): 409.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Found at depths of 91- 2000 m, usually below 400 m.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 0 - 3656 m (Ref. 58426), usually 100 - 1000 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 494 specimens in 1 taxon.
Water temperature and chemistry ranges based on 403 samples.

Environmental ranges
  Depth range (m): 0 - 4332
  Temperature range (°C): 1.433 - 27.202
  Nitrate (umol/L): 0.180 - 46.071
  Salinity (PPS): 32.279 - 38.654
  Oxygen (ml/l): 0.214 - 7.038
  Phosphate (umol/l): 0.035 - 3.294
  Silicate (umol/l): 0.885 - 163.066

Graphical representation

Depth range (m): 0 - 4332

Temperature range (°C): 1.433 - 27.202

Nitrate (umol/L): 0.180 - 46.071

Salinity (PPS): 32.279 - 38.654

Oxygen (ml/l): 0.214 - 7.038

Phosphate (umol/l): 0.035 - 3.294

Silicate (umol/l): 0.885 - 163.066
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The slender snipe eel is a deep sea, bathypelagic species occuring from the surface down to many hundred meters in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 200 - 2000m.
From 200 to 2000 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bathypelagic; marine; depth range 91 - 2000 m. Typically, below 400 m, but may be in shallower water in the northern part of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur in midwater, usually below 400 m and occasionally in shallow water in the northern part of its range. Feed on crustaceans while swimming with its mouth open (Ref. 5377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Crustaceans while swimming with its mouth open.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feed on crustaceans while swimming with its mouth open
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous (Ref. 3247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Oviparous, may be semelparous.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nemichthys scolopaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCCTGAGCCGGAATGGTGGGCACTGCACTAAGCCTACTAATCCGTGCTGAACTAAGTCAGCCTGGAGCCCTCCTTGGAGACGACCAGATTTATAATGTAATTGTTACGGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATGCCAGTAATAATTGGGGGGTTTGGCAATTGACTCATCCCGCTAATAATCGGTGCCCCGGACATAGCATTTCCCCGAATGAATAACATAAGCTTCTGGCTTCTACCGCCCTCGTTCCTTCTACTGCTAGCGTCTTCAGGAGTAGAAGCGGGTGCAGGCACAGGTTGAACAGTATACCCACCCCTATCTGGAAACTTGGCTCACGCTGGAGCGTCAGTTGACCTTACAATTTTTTCACTCCACCTTGCAGGTGTCTCGTCCATTTTGGGGGCCATTAATTTCATTACCACTATTATTAACATGAAACCCCCAGCCATCACACAATATCAAACACCCTTGTTCGTATGGGCTGTATTAGTAACGGCCGTACTGCTACTTCTATCTCTACCAGTCCTAGCTGCAGGAATCACAATACTTTTAACTGACCGAAACTTGAATACAACTTTCTTCGACCCAGCGGGAGGGGGGGACCCAATCCTTTATCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nemichthys scolopaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Slender snipe eel

The slender snipe eel, Nemichthys scolopaceus, sometimes referred to as the deep sea duck, is a fish that can weigh only a few ounces, yet reach 5 feet or 1.5 m in length. Features include a bird-like beak with curving tips, covered with tiny hooked teeth, which they use to sweep through the water to catch shrimp and other crustaceans. It has a lifespan of ten years.

It has more vertebrae in its backbone than any other animal, around 750. However, its anus has moved forward during its evolution and is now located on its throat. Its larvae are shaped like leaves, which actually get smaller before transforming into adults.

Many specimens found in museums were spat up from larger fish that were caught in trawls.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!