Overview

Comprehensive Description

Biology

Found on muddy bottoms where they hide in the mud. Slime is used for defense. Feeds chiefly on dead and dying fish of varying species by boring into the body and consuming viscera and musculature. Chiefly nocturnal. Its eggs are few in number about 19-30 and large (20-25 mm), the horny shell has a cluster of anchor-tipped filaments at each end.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The common hagfish Myxine glutinosa is a long, slender, eel-like fish. It is easy recognised by its fin-like fold of skin running continously right around the tail and forward on the lower surface of the body. The hagfish has a single gill pore on either side, just forward of the beginning of the ventral finfold. It has a jawless, lipless mouth that is star-shaped when closed. At the tip of the snout it has a single nasal aperture. There are barbels around the mouth and nasal regions. Myxine glutinosa can vary in colour possibly according to seabed type but is often grayish brown or reddish gray.Myxine glutinosa is a scavenger feeding mainly on dead fish. It is completely blind and finds its food by its greatly specialized olfactory sense. It has a peculiar habit of pouring out slime, from mucus sacs near the abdomen, in disproportionate quantities to its size (Jørgensen et al., 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), FAO fishing area 18, Gulf of Maine, Gulf of St. Lawrence, Hudson Strait, North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic: Murmansk to the Mediterranean Sea; Greenland to USA. Absent in eastern Mediterranean and Black Sea. Only hagfish in the Northeast Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

There are two populations from the North Atlantic Ocean of this species. In the eastern North Atlantic, from Murmansk (Russia) to northern Morocco, and the western Mediterranean Sea (north Morocco, Algeria, and northern Adriatic Sea, but probably occurs along all coastal regions of western Mediterranean). In the western North Atlantic, from Greenland to Florida, including a few records in the Gulf of Mexico (off Yucatán and Florida).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic from Greenland to New York
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Baltic Sea, North Sea, Mediterranean Sea, Eastern North Atlantic: Barents Sea to Gibraltar; Western North Atlantic: Davis Strait to Florida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic seas; both coasts of the north Atlantic; Murman Coast and northern Norway south regularly to the Irish Sea, rarely to Morocco; northern part of Davis Strait, south to the latitude of Cape Fear, North Carolina.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Fernholm, B.,1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 80 cm TL.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Fernholm, B.,1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Jawless mouth, single nasal aperture, only a single pair of external gill openings, no operculum or covering fold of skin. Grayish or reddish brown above, either plain. Variations in color correspond to the color of the sea bottom.
  • Bigelow, H.B. and W.C. Schroeder 1948 Cyclostomes. p. 29-58. In J. Tee-Van, C.M. Breder, S.F. Hildebrand, A.E. Parr and W.C. Schroeder (eds.) Fishes of the Western North Atlantic. Part one. Lancelets, cyclostomes, sharks. Sears Foundation for Marine Research, Yale University, New Haven. 576 p. (Ref. 34302)   http://www.fishbase.org/references/FBRefSummary.php?id=34302&speccode=2513 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; non-migratory; marine; depth range 30 - 1200 m (Ref. 31276)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found on shelves and slopes at depths from 40-1,100 m (eastern North Atlantic) and from 75-742 m depth (western North Atlantic). The maximum depth record (1,006 m) given by Wisner and McMillan (1995) for western North Atlantic population was based on a single specimen (ISH 431-1986) recently reidentified as Myxine jespersenae, which was in fact collected off southeastern Iceland (Møller et al. 2005). The sex ratio of females and males in the samples analyzed by Martini et al. (1997) was highly skewed, at 9.8:1, which is typical for the species as a whole. The paucity of males in population on both sides of the Atlantic has long been recognized, but it remains unexplained.

This species is found on muddy bottoms where they hide in the mud. Slime is utilized for defence and it feeds chiefly on dead and dying fish of varying species by boring into the body and consuming viscera and musculature. The species is chiefly nocturnal. Its eggs are few in number about 19-30 mm and large (20-25 mm), the horny shell has a cluster of anchor-tipped filaments at each end. The copulatory organ is absent in this species. The gonads of hagfishes are situated in the peritoneal cavity. The ovary is found in the anterior portion of the gonad, and the testis is found in the posterior part. The animal becomes female if the cranial part of the gonad develops or male if the caudal part undergoes differentiation. If none develops, then the animal becomes sterile. If both anterior and posterior parts develop, then the animal becomes a functional hermaphrodite. However, hermaphroditism being characterised as functional needs to be validated by more reproduction studies (Patzner 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths of 40- 1200m over muddy bottoms.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8442 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4413 samples.

Environmental ranges
  Depth range (m): -9 - 1044
  Temperature range (°C): -0.070 - 22.025
  Nitrate (umol/L): 1.402 - 23.955
  Salinity (PPS): 27.525 - 36.240
  Oxygen (ml/l): 3.207 - 7.862
  Phosphate (umol/l): 0.253 - 1.806
  Silicate (umol/l): 0.987 - 25.595

Graphical representation

Depth range (m): -9 - 1044

Temperature range (°C): -0.070 - 22.025

Nitrate (umol/L): 1.402 - 23.955

Salinity (PPS): 27.525 - 36.240

Oxygen (ml/l): 3.207 - 7.862

Phosphate (umol/l): 0.253 - 1.806

Silicate (umol/l): 0.987 - 25.595
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The hagfish is a demersal species that can usually be found on muddy bottoms hiding in the mud, potentially down to depths of over 1000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 40 - 1200m.
From 40 to 1200 meters.

Habitat: demersal. Found on muddy bottom. Feeds chiefly on dead and dying fish of varying species by boring into the body and consuming viscera and musculature. Chiefly nocturnal. Its eggs are few in number about 19-30 and large (20-25 mm), the horny shell has a cluster of anchor-tipped filaments at each end.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; marine; depth range 40-1200 m. Muddy bottoms.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Fernholm, B.,1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on soft, muddy bottoms; requires high salinity (at least 30 ppt) and low temperature (below 12°C), conditions usually found in deeper waters (Ref. 5951). Feeds chiefly on dead and dying fish of varying species by boring into the body and consuming viscera and musculature. Food includes marine invertebrates such as polychaete worms and crustaceans (shrimp, Pandalus borealis, an important food item) (Ref. 5951). Chiefly nocturnal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds chiefly on dead and dying fish of varying species by boring into the body and tissue.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Fernholm, B.,1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Copulatory organ absent. The gonads of hagfishes are situated in the peritoneal cavity. The ovary is found in the anterior portion of the gonad, and the testis is found in the posterior part. The animal becomes female if the cranial part of the gonad develops or male if the caudal part undergoes differentiation. If none develops, then the animal becomes sterile. If both anterior and posterior parts develop, then the animal becomes a functional hermaphrodite. However, hermaphroditism being characterised as functional needs to be validated by more reproduction studies (Ref. 51361 ). Probably breed throughout the year in deep water (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Functional hermaphrodite. Has 19-30 large eggs, each enclosed in a horny capsule.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Fernholm, B.,1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Slime and fibers protect: hagfish
 

Glands of hagfish protect it from predators by secreting a complex material of fibers and rapid water-absorbing slime.

   
  "Hagfishes are known for producing large volumes of slime when stressed. Their slime is believed to act as a defence mechanism against gill-breathing predators, as it has been shown to reduce water flow over the gills of fish. Hagfish slime is composed of two interacting components, slime thread skeins and mucin vesicles, which are both released from glands along the ventrolateral length of the animal. Each slime gland is surrounded by striated muscle and a connective tissue capsule, and contains large numbers of gland thread cells and gland mucous cells. Gland thread cells contain skeins of tightly coiled polymers rich in intermediate filaments, while gland mucous cells produce vesicles containing mucins, a class of glycoproteins. Both cell types rupture partially as they pass through the slime gland duct, causing each to lose its plasma membrane, and releasing both thread skeins and mucin vesicles into the external environment. The mucin vesicles are released by holocrine secretion rather than the more typical mechanism of mucus secretion through fusion of vesicles with the membrane of the mucous cell and release of mucin granules by exocytosis. In this way, the mucin vesicles remain intact until they come into contact with seawater in the external environment. 

"The mature slime is formed when exudate released from the hagfish contacts convectively mixing seawater. Agitation during mixing causes the thread skeins to uncoil to lengths of 10–17 cm, providing a large surface area to which the mucins released from the ruptured vesicles can attach. The fully formed slime is a complex network capable of confining seawater to channels between the slime threads and ruptured mucins like a fine sieve. The interaction between the thread skeins and ruptured mucins is critical for the production of the mature slime." (Herr et al. 2010:1092; citations removed from quote)

 
"When agitated, Atlantic hagfish (Myxine glutinosa) produce large quantities of slime that consists of hydrated bundles of protein filaments and membrane-bound mucin vesicles from numerous slime glands. When the slime exudate contacts seawater, the thread bundles unravel and the mucin vesicles swell and rupture. Little is known about the mechanisms of vesicle rupture in seawater and stabilization within the gland, although it is believed that the vesicle membrane is permeable to most ions except polyvalent anions. We hypothesized that the most abundant compounds within the slime gland exudate have a stabilizing effect on the mucin vesicles. To test this hypothesis, we measured the chemical composition of the fluid component of hagfish slime exudate and conducted functional assays with these solutes to test their ability to keep the vesicles in a condensed state. We found K+ concentrations that were elevated relative to plasma, and Na+, Cl– and Ca2+ concentrations that were considerably lower. Our analysis also revealed high levels of methylamines such as trimethylamine oxide (TMAO), betaine and dimethylglycine, which had a combined concentration of 388 mmol l–1 in the glandular fluid. In vitro rupture assays demonstrated that both TMAO and betaine had a significant effect on rupture, but neither was capable of completely abolishing mucin swelling and rupture, even at high concentrations. This suggests that some other mechanism such as the chemical microenvironment within gland mucous cells, or hydrostatic pressure is responsible for stabilization of the vesicles within the gland." (Herr et al. 2010:1092) 


"Hagfishes are benthic marine protovertebrates that secrete copious quantities  of slime when threatened. The slime originates as a  two-component glandular exudate comprised of coiled bundles of  cytoskeletal intermediate filaments (thread skeins) and mucin vesicles.  Holocrine secretion of the slime into seawater results in  the rapid deployment of both fibrous and mucin components, resulting  in about a liter of dilute slime. Deployment of the thread  skeins involves their unraveling in a fraction of a second from  a 150 µm-long ellipsoid bundle to a thread that is 100x longer. We hypothesized that thread  skein deployment requires both vigorous hydrodynamic mixing  and the presence of mucin vesicles, both of which are  required for whole slime deployment. Here we provide evidence  that mixing and mucin vesicles are indeed crucial for skein  unraveling. Specifically, we show that mucin vesicles mixed  into seawater swell and elongate into high-aspect ratio mucin  strands that attach to the thread skeins, transmit hydrodynamic  forces to them and effect their unraveling by loading them  in tension. Our discovery of mucin strands in hagfish slime not  only provides a mechanism for the rapid deployment of thread skeins  in vivo, it also helps explain how hagfish slime is able to  trap such impressive volumes of seawater via viscous  entrainment. We believe that the deployment of thread skeins via  their interaction with shear-elongated mucins represents a  unique mechanism in biology and may lead to novel  technologies for transmitting hydrodynamic forces to  microscale particles that would typically be immune to such  forces." (Winegard & Fudge 2010:1235)
  Learn more about this functional adaptation.
  • Downer, J. 2002. Weird Nature: An Astonishing Exploration of Nature's Strangest Behavior. Ontario: Firefly Books.
  • Herr JE; Weingard TM; O'Donnell MJ; Yancey PH; Judge DS. 2010. Stabilization and swelling of hagfish slime mucin vesicles. Journal of Experimental Biology. 213(7): 1092-1099.
  • Winegard TM; Fudge DS. 2010. Deployment of hagfish slime thread skeins requires the transmission of mixing forces via mucin strands. Journal of Experimental Biology. 213(8): 1235-1240.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myxine glutinosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTATCTTTCCCGATGATTTTTCTCCACCAATCATAAAGACATTGGTACCCTTTACCTTATTTTCGGGGCCTGAGCCGGAATAATTGGCACAGCCCTTAGCGTAATCATCCGAACAGAGTTGAGTCAGCCAGGATCCTTAATCAATAATGACCAACTCTATAATACAATTATCACAGCCCACGCATTTGTAATAATCTTTTTTATAGTAATACCTATCATAATCGGGGGCTTTGGGAACTGACTAGTCCCAATAATAATCGGCGCCCCTGATATAGCATTTCCCCGAATAAACAATATAAGCTTCTGACTTTTGCCCCCATCACTTATACTATTACTCTCCTCCTCACTAGTAAGCTCTGGAGCAGGAACTGGATGAACAGTTTATCCCCCTCTCTCTAATCACATTTCTCACATAGGCCCTTCAGTAGACCTAGCTATTTTCTCCCTTCATCTAGCAGGAGTTTCCTCAATCTTAGGGGCAATCAACTTTATCACAACAATTATTAACATAAAAACACGGTCTATAGAAATATACCATATCCCATTATTTGTATGATCAATTCTAATCACCGCAATCCTACTTCTTTTATCCTTACCTGTTTTAGCCGCAGCTATCACTATACTCCTCACAGACCGTAATCTCAACACCACCTTCTTTGACCCCTCTGGTGGAGGGGATCCCATCCTCTATCAGCATTTATTTTGATTTTTTGGCCACCCTGAAGTCTATATCCTAATTTTACCAGGATTTGGTATCATCTCTCACGTAGTAACTTTCTACTCCGGGAAAAAAGAACCTTTCGGGTATATAGGCATAGCATGAGCTATAATAGCCATCGGGTTCCTGGGGTTCATCGTATGAGCACACCACATATTTACGGTAGGGATAGACGTAGATACTCGAGCTTATTTCACCTCAGCCACAATAATTATTGCTATTCCCACAGGCGTAAAAGTCTTTAGCTGGCTAGCTACCATTCACGGAGGAGATATTAAATGAGAGCCCCCAATATTATGAGCTTTAGGCTTTATCTTTCTCTTTACTGTGGGGGGATTGACAGGAATTGTTCTCTCTAACTCATCTCTTGACGTAGTCCTTCATGACACATACTATGTGGTCGCCCACTTCCATTATGTCCTTTCTATGGGGGCAGTTTTCGCTATTATAGCGGGACTAATACACTGATTTCCTCTCTTCTCCGGATATTCAATCAACAAAACCTGAGCTAAAATTCACTTCTGAATTATGTTTACAGGAGTAAATTTAACTTTCTTTCCACAACACTTCTTAGGATTAGCAGGAATACCCCGTCGATACTCTGACTACCCAGATGCCTACTCAACATGGAATGTTTTATCTTCTATTGGCTCCATAGTCTCATTTGTGGGAACAATCATTCTAATATTTATTATCTGAGAAGCTTTTTCTTCAAAACGAGAACCAAACCCCTTAAGCCTACCTCTGTATAACCCTGAATGAATTTACGGAACCCCTCCAACTTTCCACACATTTGAAAACCCATCATACCTCAAAATTATTAAAAAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myxine glutinosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Mincarone, M.M.

Reviewer/s
Polidoro, B., Knapp, L. & Carpenter, K.E.

Contributor/s

Justification
This species is abundant and has a wide distribution from North America to Europe. A fishery is in place in the Gulf of Maine and statistics suggest that catch per unit effort (CPUE) and population abundance have locally decline. However, this fishery operates in only 5-10% of its range, and there is no indication of widespread population decline throughout the species distribution. It is listed as Least Concern. Given its commercial importance, current and future fisheries for this species should be carefully monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is known to be very abundant and has a large distribution.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Data on the developing fishery on the western Atlantic population of M. glutinosa has been collected by the National Marine Fisheries Service (NMFS) and by the New England Fisheries Development Association (NEFDA) (Martini and Flescher 2002). In 1991, two boats made 32 trips over an 8-month period. During 1993, some 890,000 lb of hagfish were landed at Gloucester, Sandwich, Hampton, and Stonington. During 1994, five boats were involved in full-time hag fishing and made a total of 796 trips. Catches rose during 1997-1999, totalling 11.5 million lb and generating approximately US $3.3 million. Over the period 1991-1996, roughly 50 million hagfish were processed and shipped overseas; during 1997-1999, that number grew to roughly 212 million. Hagfish shorter than 500 mm, the minimum length suitable for leather, are discarded into the surface waters, where they quickly become moribund. On some trips, over 50% of the catch was discarded as unmarketable. Under these conditions the number of individuals removed from the environment would be more than twice the number landed ashore. It is not known what effects such a decline will have on the benthic ecology. However, from a regulatory perspective it is obviously difficult to set defensible quotas or guidelines for a fishery when virtually nothing definitive is known about the size of the population, their reproductive potential, their individual growth rates, or their longevity.

In the Gulf of Maine (GOM), Atlantic hagfish are caught using modified 55-gallon plastic barrels, called hagfish pots, attached to sinking line and buoys. Typically 20-40 traps are deployed in a string for a small commercial vessel and 80-200 traps for larger vessels (NEFSC 2003). A series of funnelled holes in the side of the barrel allow hagfish to enter the baited pot but doesn’t allow them to escape. Several rows of 3/8” holes allow smaller animals to escape the traps.

Reporting of Atlantic hagfish landings is presently not required by law and fishery data are therefore incomplete. Atlantic hagfish landings first appear in the NEFSC commercial database in 1993 with a reported landing of approximately 500 metric tons. Annual reported landings during 1994-2000 ranged between 1,100 and 3,000 metric tons with a peak in 2000 (Keith 2006).

Reported commercial hagfish trips ranged from 94 trips in 1994 to 863 trips in 1996 and averaged slightly above 400 trips per year during 1994-2000. Landings during 2001 to 2005 have ranged from 700-1,300 metric tons per year. Trips targeting Atlantic hagfish declined after 2001, averaging 253 per year (Keith 2006) NMFS Logbook database indicated that the number of vessels in the hagfish fishery peaked at 23 vessels in 1996 and 22 vessels in 2000 (Keith 2006). Since 2000 there has been a steady decline of vessels reporting landings, with only six vessels reporting in 2005.

A data collection program has been proposed for Atlantic Hagfish by NMFS requiring seafood dealers to acquire permits and report on the purchase of hagfish made from commercial fishing vessels to aid in the future management of this species (Federal Register 2006, Keith 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
While not actively managed, the Gulf of Maine Hagfish fishery is in the process of being regulated. A data collection program has been proposed for the species by NMFS requiring seafood dealers to acquire permits and report on the purchase of hagfish made from commercial fishing vessels to aid in the future management of this species. Furthermore, given its commercial importance, current and future fisheries for this species should be carefully monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Myxine glutinosa

Myxine glutinosa, known as the Atlantic hagfish in North America, and often simply as the hagfish in Europe, is a species of jawless fish of the genus Myxine.

Contents

Distribution

The distribution of Myxine glutinosa in the eastern Atlantic Ocean extends from the western Mediterranean Sea and Portugal to the North Sea, Skagerrak, Kattegat and the Varanger Fjord.[1] It is also found in the western Atlantic Ocean from Baffin Island, Canada south to North Carolina.[2] A related species, the Gulf hagfish (Eptatretus springeri), occurs in the Gulf of Mexico.[3]

Description

The Atlantic hagfish may grow up to 2.5 feet (0.76 m) long, with no eyes and no jaws; its star-shaped mouth is surrounded by 6 barbels.[2] There is a single gill slit on each side of the eel-like body.[2] It has a total of 88–102 pores from which it can exude a slimy mucus.[1]

Ecology

Hagfish such as M. glutinosa feed on the carcasses of fishes, which they bore into through any available opening.[1][2]

Trivia

Following a public poll in 1982, it was voted to be the national fish of Norway with over 4000 votes, beating the second place ( Atlantic Cod ) by a large margin, as that only got 2,552 votes. [4]

References

  1. ^ a b c P. J. P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen & E. Tortonese, ed. (1984/1986). "Hagfish (Myxine glutinosa)". Fishes of the NE Atlantic and the Mediterranean. http://species-identification.org/species.php?species_group=fnam&id=945.
  2. ^ a b c d Michael Filisky & Roger Tory Peterson (1998). "Atlantic Hagfish". Peterson First Guide to Fishes of North America (2nd ed.). Houghton Mifflin Harcourt. p. 10. ISBN 978-0-395-91179-2. http://books.google.co.uk/books?id=Lr-5YlYlWhkC&pg=PA10.
  3. ^ Edwin S. Iversen & Renate H. Skinner (2006). "Atlantic hagfish Myxine glutinosa". Dangerous Sea Life of the West Atlantic, Caribbean, and Gulf of Mexico: A Guide for Accident Prevention and First Aid. Pineapple Press. p. 72. ISBN 978-1-56164-370-7. http://books.google.co.uk/books?id=MqyPjacQHFoC&pg=PA72.
  4. ^ Friis, R. (1982): «Slimåler» raser mot NRK/torsken, VG, s. 33, 15. november 1982
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species, as previously recognized, is assumed to occur across the North Atlantic Ocean, but Wisner and McMillan (1995) provided diagnostic characters to distinguish a western Atlantic species, Myxine limosa Girard, 1859, and an eastern Atlantic species. However, the results of Martini, Lesser and Heiser (1998) did not support a clean division between North Atlantic populations of M. glutinosa, and they recommended "that until and unless molecular data indicate otherwise, the species name M. glutinosa be retained as encompassing both eastern and western North Atlantic populations" (Nelson et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!