Overview

Brief Summary

Myliobatis californica, commonly known as bat rays, are typically found in sandy and muddy bays and estuaries, rock reefs and kelp beds from southern Oregon to the Gulf of California (Hopkins 1993). They have a flat and triangular shape (Martin and Cailliet 1988), with a whip-like tail and venomous spines (up to 2 or 3) at its base. These animals regularly feed on flat muddy bottom animals like clams and echiuroid worms (Talent 1982). The bat ray has been found in depths reaching 354 ft (107 m). The largest bat ray on record weighed 240 pounds (108 kg). They can reach up to a width of six feet (Love 2011), and can live to be at least 23 years of age (Martin and Cailliet 1988). Bat rays are generally solitary animals, except for when they are found together during feeding and mating (Martin and Cailliet 1988, Hopkins 1993). Adult bat rays reproduce annually, with a mating season in the spring and summer months (Martin and Cailliet 1988).

References:

Hopkins, T. 1993. The Physiological Ecology of Bat Rays, Myliobatis californica, in Tomales Bay, California. PhD Dissertation, University of California, Davis. Pp 11-80

Love, M. S. 2011. Certainly more than you want to know about the fishes of the Pacific Coast. Really Big Press, Santa Barbara, California.

Martin, L. K., and G.M. Calliet. 1988. Aspects of the Reproduction of the Bat Ray, Myliobatis california, in Central California. Copeia. No. 3: 754-761.

Talent, L.G. 1982. Food habits of gray smoothhound, Mustelus californicus, the brown smoothhound, Mustelus henlei, the shovelnose guitarfish, Rhinobatos productus, and the bay ray, Myliobatus californica, in Elkhorn Slough, California. Calififornia Fish and Game 68:224-234

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: bat ray (English), bat-eagle ray (English), tecolote (Espanol)
 
Myliobatis californica Gill, 1865

California bat ray,     California bat-eagle ray

Disc rhomboidal, wider than long; head and snout blunt, rounded, raised, projecting well before disc; pectorals bluntly pointed, concave at rear, continue onto rostrum; teeth in flat, pavement-like plates, with 7 series of plates, upper plates not arched; eyes and spiracles on side of head; tail slender, about as long as disc, no tail fin; 1 large spine at base of tail after small dorsal fin.

Similar to  M. peruvianus but is larger, has blunter pectoral tips and the dorsal fin origin in further forward, nearer the pelvic fins (1x rather than 2x the length of the dorsal fin base after of the pelvic fin base).

Olive to dark brown to black above, white below.

Size: 180 cm wide.

Habitat: sand, mud and rocky bottoms, and algal beds.

Depth: 1-108 m.

Oregon to the Gulf of California.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Commonly found in sandy and muddy bays and sloughs, also on rocky bottom and in kelp beds (Ref. 2850). Sometimes buries itself in sand (Ref. 2850). Found singly or in schools (Ref. 12951). Feeds on bivalves, snails, polychaetes, shrimps, and crabs (Ref. 9257). Ovoviviparous (Ref. 50449). Venomous spine on tail. Not fished commercially, but shows up as by-catch species (Ref. 9257).
  • McEachran, J.D. and G. Notarbartolo di Sciara 1995 Myliobatidae. Aguilas marinas. p. 765-768. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para los Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9257)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Bat rays are found in shallow waters and coral reefs from Oregon to the Sea of Cortez.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The bat ray occurs from Oregon, USA to Baja California, México (including the Gulf of California) in the eastern Pacific Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Oregon, USA to Gulf of California (Ref. 2850) and the Galapagos Islands (Ref. 28023).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 108 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bat rays are commonly distinguished from other rays because of their distinct, protruding head and large eyes (  a close look). They have a flat body with a dorsal fin at the base of the tail. The tail is whiplike and can be as long or longer than the width of the body. It is armed with a barbed stinger that is venomous. Bat rays are named for their two long pectoral fins that are shaped like the wings of a bat. The skin is smooth, dark brown or black and has no markings. Bat rays have a white underbelly. The skeleton is made of cartilage, instead of bone. Bat rays are usually born measuring 11.4 inches and can grow to reach 5.9 feet. Females are typically larger than males and have been found weighing up to 200 pounds. (  Details.)

Range mass: 0 to 0 kg.

Other Physical Features: bilateral symmetry

  • Michael, S. 1993. Reef Sharks & Rays of the World: A guide to their identification, behavior, and ecology.. Monterey, California: Sea Challengers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 180.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1800 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

180 cm WD (male/unsexed; (Ref. 2850)); max. published weight: 82.1 kg (Ref. 40637)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Myliobatis californica
Catalog Number: USNM 37966
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Smith & Miss. Fish
Year Collected: 1882
Locality: Near Encenada, Todos Santos B., Lower Cal., Baja California, Mexico, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bat rays   are found living close to the shores of bays, sloughs, kelp beds and coral reefs. Bat rays prefer to live in areas with sandy or muddy bottoms for it allows easier access to food. They are most commonly found in depths reaching between 3m and 12m but have occasionally been spotted as deep as 46m.

Aquatic Biomes: reef ; coastal

  • Gray, A., T. Mulligan, R. Hannah. 1997. Food habits, occurence, and population structure of the bat ray, Myliobatis Californica, in Humboldt Bay, California. Environmental Biology of Fishes, 49: 227-238.
  • Last, P., J. Stevens. 1994. Sharks and Rays of Australia. Australia: CSIRO.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Bat rays are commonly found in shallow bays and have been reported from intertidal zones to 108 m but are more common in shallower waters (Morris et al. 1996). In southern California, it occurs along the open coast and around islands where it frequents kelp beds and sandy bottoms near rocky reefs and sandy beaches.

The reproductive mode of bat rays is aplacental viviparity. Females produce up to 12 offspring (more commonly smaller litter sizes) in an annual reproductive cycle, with gestation lasting about one year (Baxter 1980, Martin and Cailliet 1988a). The pups are born at ~20 cm DW (Martin and Cailliet 1988a). Females reach a larger size and age and have a growth coefficient (k) in the von Bertalanffy growth equation of 0.0995 (Martin and Cailliet 1988b), reaching its asymptotic size (~159 cm DW) in approximately 25 years. Age at maturity for females has been observed by Martin and Cailliet (1988a) to be ~5 years, at ~88 cm DW. Males reportedly mature at ~60 cm DW and an age of ~2 to 3 years. Ageing by means of counting rings in the vertebral centra of this species has not been validated, either by tagging or by vertebral marginal increment or centrum edge analyses. In southern Baja California, México, these rays apparently mature at smaller size than reported from California with males attaining maturity between 40 and 50 cm DW and females <70 cm DW have been found to be immature (Villavicencio-Garayzar 1995, 1996), however limited biological information on the species from this region is available.

In San Francisco Bay and Elkhorn Slough in Monterey County California, parturition appears to occur from March through June, with a peak in April and May. It also reportedly occurs at approximately the same time in other bays (Humboldt, Tomales, Morro, Santa Monica and San Pedro Bay) in California (Talent 1985, Martin and Cailliet 1988a). Bays and sloughs appear to be important nursery areas. Females are also thought to release their pups along more open coastal areas in southern California, and have been observed giving birth to young in water 1m in depth over a shallow flat in Catalina Harbor. Newly born pups are reportedly found in northern California sloughs in April and May; also in the shallow surf zone in more southerly areas such as Santa Monica Bay in southern California around late May and June (Talent 1985, Martin and Cailliet 1988a, Monaco et al. 1990). In Estero de Punta Banda along the northern portion of the Baja California peninsula, M. californicus abundance increases from October to a maximum in January and become uncommon in the spring and summer months (Beltrán-Félix et al. 1986). Peak abundance of bat rays in Bahía Almejas, México along the southern portion of the Pacific Baja California peninsula occurs in March and consists primarily of adults (Villavicencio-Garayzar 1995, 1996). Both locations appear to serve as pupping and reproductive grounds for the bat ray.

This ray is an opportunistic benthic feeder, consuming numerous types of bottom-dwelling invertebrates, including the eggs of some fish species such as herring, topsmelt, jacksmelt, and midshipman (Talent 1982). Pups caught in places like Elkhorn Slough consume crustaceans and molluscs (Barry et al. 1996). Bat rays are preyed upon by larger sharks such as the sevengill, Notorynchus cepedianus, and white, Carcharodon carcharias, (Ebert 1989) as well as pinnipeds. However, man is probably the most important predator. The bat ray occasionally occurs in epipelagic schools (Walford 1935, Roedel and Ripley 1950). Movement patterns may be associated with thermal tolerance or preference (Matern et al. 2000). Although it possesses a spine, this ray is not considered dangerous. Groups kept in aquaria have been observed to interact with each other and with visitors (G. and V. Dykhuizen, pers. comm).

Life history parameters
Age at maturity: 50% maturity: 5 years (Martin and Cailliet 1988b) (female); First maturity: 2 to 3 years (Martin and Cailliet 1988b) (male).
Size at maturity (disc width): 50% maturity: 88.1 cm DW (Martin and Cailliet 1988a) (female); Maturity: 45 to 62.2 cm DW (Martin and Cailliet 1988a), first maturity (Bahía Almejas): 50 cm DW, 100% maturity: 60 cm DW (Villavicencio-Garayzar 1996) (male).
Longevity: At least 24 years (females) (Martin and Cailliet 1988b).
Maximum size (disc width): 180 cm DW (Eschmeyer et al. 1983).
Size at birth: 22 to 35.6 cm DW (Baxter 1980, Martin and Cailliet 1988b).
Average reproductive age (years): Unknown.
Gestation time: 9 to 12 months (Martin and Cailliet 1988a).
Reproductive periodicity: Annual.
Average annual fecundity or litter size: 2 to 12 pups (Baxter 1980; Martin and Cailliet 1988a).
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bat rays, Myliobatis californica, forage in shallow mudflats and seagrass beds in coastal waters ranging from central Oregon to the Gulf of California (Miller and Lea 1972, Gray et al. 1997). As large, benthic predators, they can alter benthic habitats and the associated invertebrate populations through their feeding habit of creating pits in soft sediments up to 4m long and 20cm deep. Bat rays typically migrate into bays and estuaries during the spring and summer months to reproduce (Gray et al. 1997).

References:

Gray, A.E., T.J. Mulligan and R.W. Hannah. 1997. Food habits, occurrence, and population structure of the bat ray, Myliobatis californica, in Humboldt Bay, California. In Environmental Biology of Fishes. Kluwer Academic Publishers, Netherlands. 49:227-23

Hopkins, T. 1993. The Physiological Ecology of Bat Rays, Myliobatis californica, in Tomales Bay, California. PhD Dissertation, University of California, Davis. Pp 11-80

Miller, D.J. and R.N. Lea. 1972. Guide to the coastal marine fishes of California. Calif. Dept. Fish Game, Fish Bull. 157:1-249

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 46 m (Ref. 12951)
  • Michael, S.W. 1993 Reef sharks and rays of the world. A guide to their identification, behavior, and ecology. Sea Challengers, Monterey, California. 107 p. (Ref. 12951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 15
  Temperature range (°C): 19.804 - 21.311
  Nitrate (umol/L): 0.144 - 0.860
  Salinity (PPS): 34.213 - 34.246
  Oxygen (ml/l): 5.074 - 5.165
  Phosphate (umol/l): 0.352 - 0.521
  Silicate (umol/l): 3.264 - 4.304

Graphical representation

Depth range (m): 0 - 15

Temperature range (°C): 19.804 - 21.311

Nitrate (umol/L): 0.144 - 0.860

Salinity (PPS): 34.213 - 34.246

Oxygen (ml/l): 5.074 - 5.165

Phosphate (umol/l): 0.352 - 0.521

Silicate (umol/l): 3.264 - 4.304
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 46m.
From 1 to 46 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Rocks, Macroalgae, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Some bat rays, Myliobatis californica, follow an annual migration pattern, returning to important nursery areas in California, such as Elkhorn Slough, Tomales Bay, and Humboldt Bay during the spring and summer months to mate and reproduce (Martin and Calliet 1988, Gray et al. 1997, Matern et. al 2000). They then typically leave these habitats when the temperatures drop below 10°C (Gray et al. 1997). It has also been suggested based on movement patterns through different water temperatures that Myliobatis californica use behavioral thermoregulation (Matern et. al 2000).

References:

Gray, A.E., T.J. Mulligan and R.W. Hannah. 1997. Food habits, occurrence, and population structure of the bat ray, Myliobatis californica, in Humboldt Bay, California. In Environmental Biology of Fishes. Kluwer Academic Publishers, Netherlands. 49:227-23

Hopkins, Todd. 1993. The Physiological Ecology of Bat Rays, Myliobatis californica, in Tomales Bay, California. PhD Dissertation, University of California, Davis. Pp. 11-80

Martin, L.K., and G.M. Calliet. 1988. Aspects of the Reproduction of the Bat Ray, Myliobatis california, in Central California. Copeia. No. 3: 754-761.

Matern, S.A., J J. Cech and T.E. Hopkins. 2000. Diel movements of bat rays, Myliobatis california, in Tomales Bay, California: evidence for behavioral thermoregulation? Environmental Biology of Fishes, 58: 171-180.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bat rays are carnivorous and feed on a variety of molluscs, crustaceans, and small fishes. Diet varies with the abundance of prey locally. Juveniles eat primarily clams and shrimp. Adult bat rays eat larger prey, including larger clams, crabs, shrimp, and echiuran worms.

Bat rays use their snout to dig invertebrates from the sand, making bat rays an important benthic predator. They also capture prey by lifting the body on the pectoral fin tip, flapping the pectoral tips quickly up and down, and then using the suction created by the flapping to pull sand out from under the body, exposing hidden prey. When bat rays feed on molluscs, they eat the entire animal, crush the shell inside of the mouth, spit out the hard shell pieces, and then eat the soft part of the mollusc body. Bat rays, depending on size, may burrow with their nose deeper into the sand or mud bottoms in an effort to eat larger prey.

Animal Foods: mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

  • Talent, L. 1982. Food Habits of the Gray Smoothhound, Mustelus Californicus, the Brown Smoothhound, Mustelus Henlei, the Shovelnose Guitarfish, Rhinobatos Productus, and the Bat Ray, Myliobatis Californicus, in Elkhorn Slough, California. California Fish and Game, 68: 224-234.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Also in Ref. 9137.
  • Talent, L.G. 1982 Food habits of the gray smoothhound, Mustelus californicus, the brown smoothhound, Mustelus henlei, the shovelnose guitarfish, Rhinobatos productus, and the bat ray, Myliobatis californica, in Elkhorn Slough, California. Calif. Fish Game 68(4):224-234.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myliobatic californica (bat ray) dietary habits change with the size of the animal. As bat rays grow, the prey they feed on also increase in size. Smaller bat rays tend to eat more clams. In contrast, larger bat rays, typically greater than 80cm, eat more echiuroid worms. Polychaetes, crabs (cancer and bay crabs), shrimp, sea cucumbers and brittle stars are also consumed by bat rays, but make up a small portion of their diet. Bat rays have been observed to capture prey that are burrowed into soft sediments by actively digging, often creating pits up to 4m long and 20cm deep (Talent 1982, Gray et al. 1997).

References:

Gray, A.E., T.J. Mulligan and R.W. Hannah. 1997. Food habits, occurrence, and population structure of the bat ray,Myliobatis californica, in Humboldt Bay, California. Environmental Biology of Fishes. Kluwer Academic Publishers, Netherlands. 49:227-238

Talent, L.G. 1982. Food habits of gray smoothhound, Mustelus californicus, the brown smoothhound, Mustelus henlei, the shovelnose guitarfish, Rhinobatos productus, and the bay ray, Myliobatus californica, in Elkhorn Slough, California. California Fish and Game, 68:224-234

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators of the bat ray are California sea lions and broadnose sevengill sharks.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Bat rays have been known to live up to 23 years.

Range lifespan

Status: wild:
23 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bat rays reproduce on an annual cycle, usually copulating during the spring or summer of one year and then giving birth the following spring or summer. The male chooses his mate by following close behind her and assessing her reproductive condition by smelling her chemical signals. When the male has found a suitable mate, he continues to swim close behind and moves under so that his back is touching her stomach. He rotates a clasper up and to the side of the female. After inserting it into her cloaca, they swim together with synchronous beats of the pectoral fins. Many times, males will fight over a particular female. The female may end up having more than one male clinging onto her pectoral fins at one time and will wait for one of the males to finally flip her into the correct position. Bat rays reproduce in large mating aggregations with the females clustering in one area. Females may lie on top of one another, burying females that have already mated or those that are not sexually mature yet. This allows less confusion for the males to pick a suitable mate.

The gestation period is between 8-12 months and the number of live young born depends upon the size of the mother but can be up to 10 pups at a time. The female enters a bay area to deliver in an effort to protect from larger predators in the ocean and to allow access to a more stable food source. The young pups do not require any parental care and are born with stingers ready to protect from predators. Before bat rays are actually born, the stinger is pliable and has a sheath that is sloughed. It protects the mother from the dangerous stinger during delivery but is immediately lost at the time of delivery. Bat rays reach sexual maturity around the age of 5 years, usually when they measure from wing tip to wing tip 67-68 cm.

  • Last, P., J. Stevens. 1994. Sharks and Rays of Australia. Australia: CSIRO.
  • Michael, S. 1993. Reef Sharks & Rays of the World: A guide to their identification, behavior, and ecology.. Monterey, California: Sea Challengers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gestation period of Myliobatis californica (bat rays) has been found to last between 9 months to a full year, with females carrying between 2-12 embryos (as cited in Martin et al. 1988). Bat rays have an annual reproduction cycle. There are an increase in juvenile bat rays found in the spring and summer months. Male bat rays reach sexual maturity at 2-3 years of age, while females reach maturity at approximately 5 years of age. A distinct annual reproductive pattern is suggested by reproductive behaviors, ovulating females and full-term fetuses all being observed during the summer months (Martin et al. 1988).

References:

Martin, L.K., and G.M. Calliet. 1988. Aspects of the Reproduction of the Bat Ray, Myliobatis california, in Central California. Copeia. No. 3: 754-761.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kristine Kocjan, Morgan McClafferty, Taylor Renshaw

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myliobatis californica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTGATCTTTGGTGCATGAGCAGGGATAGTGGGTACTGGCCTCAGCCTACTAATTCGAACAGAACTAAGTCAACCAGGGGCCTTGTTGGGTGACGACCAAATTTATAATGTGATCGTTACCGCCCATGCCTTTGTAATAATTTTCTTCATGGTCATACCAATCATGATCGGTGGTTTCGGTAATTGATTAGTCCCCTTGATGATCGGTGCCCCAGACATAGCCTTCCCACGAATAAATAATATAAGTTTCTGACTTCTACCCCCATCTTTTCTTCTACTACTAGCCTCAGCAGGAGTAGAGGCCGGGGCTGGTACTGGGTGAACTGTTTATCCCCCTCTAGCTGGCAACCTAGCACATGCTGGGGCCTCTGTAGATTTAACTATCTTTTCCCTACATCTAGCAGGGGTTTCCTCTATTCTGGCATCAATCAATTTTATCACCACAATTATTAACATAAAACCACCCGCAATTTCTCAATACCAAACACCCCTCTTTGTCTGATCTATTCTTATTACAACCATTCTTCTCTTATTGTCCCTGCCCGTTCTGGCAGCAGGCATCACCATGCTCCTCACAGATCGTAATCTTAATACAACCTTCTTCGACCCTGCAGGGGGTGGTGACCCCATTCTTTACCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myliobatis californica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Bat rays were once persecuted in parts of coastal California because they were thought to prey on cultivated oysters. Bat rays were routinely killed in their nursery grounds, devastating local populations.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Cailliet, G.M. & Smith, W.D.

Reviewer/s
Kyne, P.M., Fowler, S.L. & Compagno, L.J.V. (Shark Red List Authority)

Contributor/s

Justification
The Bat Ray was assessed as Least Concern on the 2000 Red List. It is updated here due to new and better information available and remains Least Concern globally but is assessed as Data Deficient in México.

This abundant eastern Pacific coastal ray is relatively fast-growing, reaching maturity at around 2 to 3 years for males and five years for females. It produces up to 12 pups per year although smaller litter sizes are more common. It is not a main target of any major fishery, being taken in the US primarily by recreational anglers and only secondarily by commercial fishermen. In México, it is taken in directed elasmobranch fisheries and as bycatch in other fisheries. There are no reliable population estimates, catch data are unreliable with some catches unreported or generically reported as "ray", and catch per unit effort data do not exist. However, it does not appear that the commercial or recreational catches pose any threat to this population in US waters, which represent a sizeable portion of its range and the main centre of distribution for this species. Myliobatis californicus is considered to be a species of Least Concern at the time of this assessment. Improved recording and monitoring of landings in Mexican artisanal and industrial fisheries are needed and the species is assessed as Data Deficient in the Mexican Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Least concern

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Pacific coast and Gulf of California stocks may be disjunct subpopulations, since there are few taken in the southern Gulf of California (C. Villavicencio-Garayzar pers. comm.). No information on the population size or subpopulations is available.

Centres of abundance in US Pacific coast estuaries appear to be Elkhorn Slough and San Francisco, Tomales, Humboldt, Morro, Santa Monica, and San Pedro Bays in California (Talent 1985, Gray et al. 1997, Ebert 2003). Other California bays such as Drakes Estero in northern California, and Alamitos, Anaheim, Newport, Mission, and San Diego Bays in southern California are also frequented by this species (Monaco et al. 1990). In México, these rays are uncommonly reported in the southern Gulf of California but are often observed or captured in the Pacific coast of Baja and the northern Gulf of California.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Directed artisanal elasmobranch fisheries (in México).

Recreational fisheries (in U.S.).

Indirect landings by demersal trawls, longlines, and gillnets (in U.S. and México).

Bat rays are not directly targeted but are landed in multi-species artisanal elasmobranch fisheries in México. Fishery surveys conducted in the Gulf of California (Notarbartolo di Sciara 1987, Hueter et al. unpublished data) and Bahía Magdalena lagoon complex (Villavicencio-Garyazar 1995, Bizzarro and Smith unpublished data) indicate that this species is not a common component of artisanal landings. No information is available on the species' contribution to bycatch in other artisanal or trawl fisheries, but they are taken in shrimp trawls.

In Humboldt Bay, California, bat rays were persecuted because of perceived predation on commercial oyster beds. This activity was undertaken under permit by the oyster company and an average of over 1,100 individuals (minimum in one year, two; maximum, 9,197) were removed from 1956, with a total reported catch of 42,996 rays from 1956 to 1992 (Gray 1994, Gray et al. 1997). Bat rays were captured by trawl, longline and trap, however, information on fishing effort is not available. Furthermore, there are no details of population size that would allow the detection of changes in density as a result of this removal policy, and so the localized affect of this practice is unknown. Gray (1994) demonstrated that predation by bat rays in oyster beds was in fact rare which later prompted a change in the oyster company permit and extermination effectively ceased. Ironically, bat rays fed extensively on red rock crabs, a major oyster predator (Gray 1994, Gray et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bat Ray is presently one of the many species considered, but not yet actively regulated, under the Pacific Fishery Management Council?s Groundfish Management Plan for the U.S. eastern Pacific. Additionally, the state has general restrictions on usage of certain types of commercial gear in the nearshore zone, which offers a good degree of protection for Bat Rays and Angel Sharks Squatina californica (Leet et al. 2001). Thus, despite the fact that there are no current conservation measures the demand for bat ray has been relatively low allowing for some protection for this species, at least within the centre of its U.S. distribution at the present time. More needs to be learned about the status of critical reproductive and nursery habitat. Possible future fishing mortality increases within regulatory constraints could be a concern if mature females become an increasingly important component of the catch, or if inshore fisheries develop that are efficient at targeting this species. Considering its localised and limited distribution, it is unknown how much additional fishing pressure might be necessary to exceed its intrinsic compensatory limits and subject it to recruitment overfishing. In addition, a re-assessment of the combined sport and commercial harvest is recommended.

In México, a moratorium on the issue of elasmobranch fishing permits was enacted in 1993, but no formal management plan has been implemented for M. californicus specifically or for most other chondrichthyans. However, legislation is currently being developed in México to establish national elasmobranch fishery management. Elasmobranch landings in México are poorly monitored and lack species specific details. All batoids are generally broadly termed ?manta raya? in catch records. Although easily identified, these rays are rarely documented on a species-specific basis in México. Improved clarity in catch records would provide an essential basis for detecting fishery trends and are needed throughout the species? range. Expanded monitoring of directed elasmobranch catches and bycatch in México is necessary to provide valuable information on the biology and population status of these rays.

In addition to species-specific landings and bycatch details, life history information including age, growth, longevity, movement patterns, habitat use, and further reproductive studies throughout its range are needed from the southern portion of the species? range. Fishery-independent surveys of this and other demersal elasmobranchs are necessary to provide estimates of abundance and biomass. Tagging, tracking, and genetic studies are essential for determining the population structure, movement patterns, and possible subpopulations of this ray.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA?Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the USA and Mexico. At the time of writing, the USA has developed a National Plan of Action (NPOA), while Mexico had developed a NPOA but implementation has been blocked by industry (Anon. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative impacts of bat rays on humans. They were once thought to eat large numbers of cultivated oysters in coastal California. However, research demonstrated that bat rays only rarely prey on oysters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because bat rays are large predators that use their snouts to dig up food, they wind up creating extremely large pits up to 4m long and 20 cm deep. These large pits allow access to small organisms that may be the food of smaller fish. Small fish rely on this relationship with bat rays because a lot of them are unable to dig their own food out of the sand.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

aquarium: public aquariums
  • Ferguson, A. and G. Cailliet 1990 Sharks and rays of the Pacific Coast. Monterey Bay Aquarium, Monterey, California, USA. 64 p. (Ref. 12091)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bat ray

The bat ray (Myliobatis californica)[1][2][3] is an eagle ray found in muddy or sandy sloughs, estuaries and bays, kelp beds and rocky-bottomed shoreline in the eastern Pacific Ocean, between the Oregon coast and the Gulf of California. It is also found in the area around the Galápagos Islands.[4] The largest specimens can grow to a wingspan of 1.8 m (5 ft 11 in) and a mass of 91 kg (201 lb).[5] They more typically range from 9.07–13.61 kg (20.0–30.0 lb). Bat rays are euryhaline, i.e. they are able to live in environments with a wide range of salinities.

Diet[edit]

Bat rays feed on mollusks, crustaceans and small fish on the seabed, using their winglike pectoral fins to move sand and expose prey animals. They may also dig trenches up to 20 cm deep to expose buried prey, such as clams. Bat ray teeth are flat and pavementlike, forming tightly-packed rows that are used for crushing and grinding prey—the crushed shells are ejected and the flesh consumed. As with all elasmobranchs, these teeth fall out and are replaced continuously.[4][5]

Relation to humans[edit]

While the bat ray, like other stingrays, has a venomous spine in its tail (near the base), it is not considered dangerous and uses the spine only when attacked or frightened.

Currently, the bat ray is fished commercially in Mexico but not the United States. However, it is sometimes fished for sport for its fighting characteristics. Prehistorically, native tribes on the California coast (probably Ohlone), especially in the San Francisco Bay area, fished bat rays in large numbers, presumably for food.[6]

Commercial growers have long believed bat rays (which inhabit the same estuarine areas favored for the industry) prey on oysters, and trapped them in large numbers. In fact, crabs (which are prey of bat rays) are principally responsible for oyster loss. Bat rays are not considered endangered or threatened.[5]

Bat Rays are popular in marine parks, and visitors are often allowed to touch or stroke the ray, usually on the wing.

Life cycle[edit]

Bat ray reproduction is ovoviviparous. They mate annually, in the spring or summer, and have a gestation period of nine to twelve months. Litter sizes range from two to ten — pups emerge with their pectoral fins wrapped around the body, and the venomous spine is flexible and covered in a sheath which sloughs off within hours of birth. Bat rays live up to 23 years.[5][7]

Bat rays copulate while swimming with synchronized wingbeats—the male under the female. The male inserts a clasper into the female's cloaca, channeling semen into the orifice to fertilize her eggs.[7]

Gallery[edit]

References[edit]

  1. ^ Gill, T.N. (1865). "Note on the family of myliobatoids, and on a new species of Aetobatis". Ann. Lyc. Nat. Hist. N. Y. 8, 135–138.
  2. ^ "Myliobatis californica". Integrated Taxonomic Information System. Retrieved 11 March 2006. 
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Myliobatis californica" in FishBase. January 2006 version.
  4. ^ a b Florida Museum of Natural History. Bat Ray Biological Profile. Retrieved 2006-01-16.
  5. ^ a b c d Monterey Bay Aquarium Online Field Guide. Bat Ray. Retrieved 2012-06-14.
  6. ^ Gobalet, Kenneth W., Peter D. Schulz, Thomas A. Wake and Nelson Siefkin (2004). "Archaeological perspectives on native American fisheries of California, with emphasis on steelhead and salmon". Transactions of the American Fisheries Society 133 (4), 801–833.
  7. ^ a b MarineBio.org. Bat Ray. Retrieved 2006-01-16
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!