Overview

Comprehensive Description

Description

  Common names: smoothhound (English), tiburón (Espanol), musola (Espanol)
 
Mustelus californicus Gill, 1864


Grey smoothhound


Elongate, slender body; short, narrow head; snout pointed; mouth short (length ~ eye length), angular; eyes horizontal ovals, with ventral nictitating membranes; teeth low, with irregular blunt edges; nostril length 63-77% of distance between nostrils; wide between nostrils; spiracle length 0.3-0.8% of TL; upper and lower lip folds ~ same length; 5 gill slits, last 2 over pectoral fin base; 2 large dorsal fins, second slightly smaller than first dorsal triangular, with midpoint nearer origin of pelvic than origin of pectoral; anal fin smaller than and with origin under middle of second dorsal; tail strongly asymmetrical, lower tail lobe not expanded, not with concave rear edge; crowns of skin denticles on flank elongate, pointed, sometimes with canal in front half.


Grey, paler below; rear edges of dorsal, anal and tail fins not dark.



Size: 124 cm.

Habitat: offshore, continental shelf, demersal, often on mud bottoms.

Depth: 2-95 m.

California to the Gulf of California and central Mexico.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A common inshore and offshore shark found on the continental shelves, and entering shallow muddy bays. Feeds mostly on crabs, including cancrids and grapsids, ghost shrimp, innkeeper (echiuroid) worms (Urechis), and small fish (herring and midshipmen, Porichthys). Viviparous (with a yolk-sac placenta), with 2 to 5 young in a litter. Utilized for human consumption.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eastern central Pacific: Cape Mendocino, northern California to Mazatlan in the southeastern Gulf of California (Eschmeyer et al. 1983, Compagno 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: northern California, USA to the Gulf of California. At the southern part of its range, this species is sympatric with Mustelus lunulatus, but the two are readily distinguishable.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 2 (S) - 95 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 124.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1160 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

116 cm TL (male/unsexed; (Ref. 244)); 124 cm TL (female); max. reported age: 9 years (Ref. 6098)
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
  • Yudin, K.G. and G.M. Cailliet 1990 Age and growth of the gray smoothhound, Mustelus californicus, and the brown smoothhound, M. henlei, from central California. Copeia 1990(1):191-204. (Ref. 6098)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found both inshore and offshore in warm-temperate to tropical waters. It is demersal, on continental shelves and enters shallow muddy bays (Compagno in prep). It moves into north-central Californian waters, USA in summer, but is resident in warmer waters from southern California and south (Compagno in prep). In California it is usually found in water less than 12 m deep, but has been caught down to depth of 67 m (Sandell 1973, Ebert 2003). In the northern Gulf of California it is abundant mainly at depths less than 100 m, although has been caught from 6-265 m (Pérez-Jiménez 2006). This species is viviparous with a yolk sac placenta, and litters range from 3-16 pups (Talent 1985, Yudin 1987, Pérez-Jiménez 2006). Reproduction is annual and gestation takes about 10-12 months (Sandell 1973, Yudin 1987, Pérez-Jiménez 2006). Data from central California indicates that males mature at 57-65 cm total length (TL) (Yudin and Cailliet 1990), and data from the Northern Gulf of California suggests they mature at 72-74 cm TL (Pérez-Jiménez 2006). Females mature at 70-90 cm TL (Yudin and Cailliet 1990, Pérez-Jiménez 2006). Maximum recorded size for this species is 160 cm TL (Eschmeyer et al. 1983). Males mature at age 1-2.5 years, females mature at 2-3 years and longevity is nine years (Yudin and Cailliet 1990, Pérez-Jiménez 2006). Size at birth is 20-30cm (Sandell 1973, Talent 1985, Yudin 1987, Yudin and Cailliet 1990, Pérez-Jiménez 2006). Average reproductive age is estimated at 4.6 years (Cortés 2000).

This shark tends to move around in schools and has often been observed to congregate with leopard sharks in very shallow water (Ebert 2003). Marquez-Farias (2000) report that this, and another small shark species (Rhizoprionodon longurio, M. lunulatus and M. henlei), make seasonal migrations in Sonora state (northeastern Gulf of California) during the autumn and winter months. Elkhorn Slough and Anaheim Bay, California have both been reported as being nursery areas for this species. In Elkhorn Slough parturition occurs from January to May (Yudin 1987). In Anaheim Bay, mating reportedly occurs from February to June and parturition from March to June (Sandell 1973). In the Upper Gulf of California (the shallow (depth <30 m), tidal area at the head of the Gulf of California) mating and parturition is thought to occur from March to June and the region is considered a nursery area for this species (Pérez-Jiménez 2006). The diet of this species in California waters consist of crustaceans [Grapsidae (Hemigrapsus oregonensis), Cancridae (Cancer spp.), Hippidae (Emerita analoga), Callianassidae], echiuran worms [Urechidae (Urechis caupo)], cephalopods [Loliginidae (Loligo opalescens)], small teleosts, bivalves (Sandell 1973, Talent 1982, San Filipo 1995). In the Northern Gulf of California the diet consist of crustaceans (mainly Stomatopoda), cephalopods and teleosts (Méndez-Loeza 2004). Mustelus californicus is a relatively fast growing species, with relatively short longevity, early age at first maturity (Yudin and Cailliet 1990) and moderate fecundity, and therefore has a higher recovery capability from fishing pressure than other slower growing sharks (Smith 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 200 m (Ref. 55308), usually 2 - 46 m (Ref. 55308)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1.5 - 88
  Temperature range (°C): 10.343 - 16.549
  Nitrate (umol/L): 17.373 - 30.223
  Salinity (PPS): 33.613 - 34.816
  Oxygen (ml/l): 0.767 - 3.940
  Phosphate (umol/l): 1.439 - 2.132
  Silicate (umol/l): 18.051 - 21.239

Graphical representation

Depth range (m): 1.5 - 88

Temperature range (°C): 10.343 - 16.549

Nitrate (umol/L): 17.373 - 30.223

Salinity (PPS): 33.613 - 34.816

Oxygen (ml/l): 0.767 - 3.940

Phosphate (umol/l): 1.439 - 2.132

Silicate (umol/l): 18.051 - 21.239
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild) Observations: Unverified estimates suggest these animals may live up to 12 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustelus californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATTTTTGGTGCATGAGCAGGCATAGTTGGGACAGCTCTTAGCCTTCTAATTCGAGCCGAACTTGGGCAGCCAGGGTCACTCTTAGGTGATGATCAGATTTACAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTCTTTATGGTCATACCAATCATAATTGGAGGCTTTGGAAATTGACTGGTCCCCTTGATAATTGGTGCTCCAGACATAGCTTTCCCACGTATGAATAACATAAGCTTCTGACTCCTCCCACCATCATTTCTTCTTCTTCTTGCTTCTGCAGGAGTGGAAGCCGGTGCAGGCACCGGCTGAACAGTATATCCACCACTAGCTAGCAATCTAGCCCATGCTGGGCCATCTGTTGATTTAGCCATCTTCTCCCTTCATTTGGCCGGTATTTCATCAATCTTAGCCTCAATTAACTTTATTACGACTATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTCGTAACTACTATTCTCCTTCTTCTCTCCCTGCCAGTTCTTGCAGCAGGGATTACGATATTACTTACAGACCGAAACCTTAATACTACATTCTTTGACCCCGCAGGGGGAGGGGACCCAATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustelus californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Pérez-Jiménez, J.C. & Carlisle, A.B.

Reviewer/s
Stevens, J.D., Dudley, S., Pollard, D. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
This common demersal shark is found from Cape Mendocino, northern California to Mazatlan in the southeastern Gulf of California, Eastern Central Pacific. It usually occurs in shallow waters, from 8 m depth, but has been found offshore to depths of 265 m. This species is viviparous, with a yolk sac placenta. It is taken as bycatch in California and is both a target and bycatch of trawl and gillnet fisheries off Mexico. Despite continued fishing pressure there is no evidence to suggest this species has declined. This is a relatively fast-growing shark, with relatively short longevity (approximately nine years), early age at first maturity (2-3 years for females) and moderate fecundity (3-16 pups per litter), and is therefore considered to have a high capacity for recovery from fishing pressure compared to other sharks. These life-history characteristics, combined with no evidence to suggest the species has declined result in an assessment of Least Concern. Given that fishing pressure is continuing, catch levels need to be quantified and catch and population trends should be monitored carefully.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is considered common in most parts of its range, but it is rare north of Elkhorn Slough, California. It is common in inshore waters off southern California (Castro 1996, Ebert 2003, Compagno in prep).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In the USA this species is regularly caught by recreational anglers in southern California and is of little economic value (Ebert 2003). In the northern Gulf of California Mustelus species have been caught by the artisanal fishing fleet since the 1980s (Cudney and Turk 1998) and by the medium size trawl fleet since 1996, when 59 shrimp trawler vessels obtained fishing permits to catch finfish and elasmobranch species out of the shrimp fishing season. When they are not being targeted, they are taken as bycatch by the shrimp trawl fleet (Sustentabilidad y Pesca Responsible en México: Evaluación y manejo 1997-1998). No catch data are available but these trawl vessels operate in shallow waters where this species is present.

In the Upper Gulf of California this species is frequently targeted with bottom gill-nets (4-6 inches mesh size) from March to July, especially when most valuable teleost species are not abundant. Neonates are not thought to be vulnerable to the gill-nets used because they are smaller than the mesh size (4, 6, 8 inches) in this area. In this region the catches can be as high as 500 kg per fishing trip. In the northern Gulf of California it is commonly caught by medium size trawl vessels that target finfish and elasmobranchs from April to July (at depths shallower than 100 m), and is bycatch in the shrimp fishery from September to January (Pérez-Jiménez 2006).

Marquez-Farias (2000) report that this, and another small shark species (Rhizoprionodon longurio, M. lunulatus and M. henlei), in the Sonora state (northeastern Gulf of California) are sometimes caught in numbers as high as 1,200-1,500 individuals per fishing trip. In three regions of the Gulf of California (Southeastern, Central and Northern) the highest catches of M. californicus obtained by a trawler vessel (operating at depths of 1-200 m) were: a) 51 kg/h-1 during February-March at depths of 41?80 m in the Southeastern Gulf of California (Sonora and Sinaloa coasts) , b) 106.43 kg/ h-1 during September at depths from 81-120 m in the Central Gulf of California (Midriff Islands) and, c) 186 kg/h-1 during May at depths of 81-120 m in the Northern Gulf of California (Ehrhardt et al. 1980). Although these authors state that these catches only included M. californicus, they may also have included M. lunulatus in shallower areas (from 1-80 m) and M. henlei in deeper areas (from 80-200 m). In Santa Rosalillita, Baja California (approximately 400 km south of Ensenada) 4,638 kg of Mustelus species were caught from May to September 2001 (Rodríguez-Medrano and Almeda-Jauregui 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific management measures in place for this species.

A set of national regulations, the Mexican Official Standard Rules for Shark and Ray responsible fisheries (NOM-029-PESC-2004-2006) entered into place in May 2007. These rules state that every individual kept aboard commercial shark fishery vessels must be completely utilised, however, oceanic vessels may discard the shark guts and head. They also state that shark finning is prohibited. No information is available on how effectively these regulations are enforced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grey smooth-hound

The grey smooth-hound (Mustelus californicus) is a houndshark of the family Triakidae,. It is found on the continental shelves of the subtropical eastern Pacific, from northern California to the Gulf of California, between latitudes 40° N and 23° N, from the surface to a depth of 200 m. It can grow up to a length of 1.24 m.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!