Overview

Comprehensive Description

Description

  Common names: smoothhound (English), tiburón (Espanol), musola (Espanol)
 
Mustelus californicus Gill, 1864


Grey smoothhound


Elongate, slender body; short, narrow head; snout pointed; mouth short (length ~ eye length), angular; eyes horizontal ovals, with ventral nictitating membranes; teeth low, with irregular blunt edges; nostril length 63-77% of distance between nostrils; wide between nostrils; spiracle length 0.3-0.8% of TL; upper and lower lip folds ~ same length; 5 gill slits, last 2 over pectoral fin base; 2 large dorsal fins, second slightly smaller than first dorsal triangular, with midpoint nearer origin of pelvic than origin of pectoral; anal fin smaller than and with origin under middle of second dorsal; tail strongly asymmetrical, lower tail lobe not expanded, not with concave rear edge; crowns of skin denticles on flank elongate, pointed, sometimes with canal in front half.


Grey, paler below; rear edges of dorsal, anal and tail fins not dark.



Size: 124 cm.

Habitat: offshore, continental shelf, demersal, often on mud bottoms.

Depth: 2-95 m.

California to the Gulf of California and central Mexico.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A common inshore and offshore shark found on the continental shelves, and entering shallow muddy bays. Feeds mostly on crabs, including cancrids and grapsids, ghost shrimp, innkeeper (echiuroid) worms (Urechis), and small fish (herring and midshipmen, Porichthys). Viviparous (with a yolk-sac placenta), with 2 to 5 young in a litter. Utilized for human consumption.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Gray Smooth-hound is found in the eastern central Pacific Ocean, ranging from Cape Mendocino in northern California to Mazatlan, Mexico in the southeastern Gulf of California (Ebert 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 2 (S) - 95 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: northern California, USA to the Gulf of California. At the southern part of its range, this species is sympatric with Mustelus lunulatus, but the two are readily distinguishable.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 124.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1160 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

116 cm TL (male/unsexed; (Ref. 244)); 124 cm TL (female); max. reported age: 9 years (Ref. 6098)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species is found both inshore and offshore in warm-temperate to tropical waters. It is demersal on continental shelves and enters shallow muddy bays (Ebert 2003, Ebert et al.2013). It moves into north-central California waters in summer, but is resident in warmer waters from southern California and south to Mexico(Ebert 2003, Ebertet al.2013). In California it is usually found in water < 12 m deep, but has been caught at a depth of 67 m (Sandell 1973, Ebert 2003). In the northern Gulf of California, the species has been caught at depths ranging between 6-265 m with the majority of catches occurring at depths < 80 m where the species is abundant (Prez-Jimnez et al. 2010).

This shark tends to travel in schools and has often been observed to congregate with Leopard Shark (Triakis semifasciata)in very shallow water (Ebert2003). Marquez-Farias (2000) report that this smooth-hound and other small shark species(including Rhizoprionodon longurio,M. lunulatusandM. henlei), make seasonal migrations in Sonora state (northeastern Gulf of California) during the autumn and winter months. Espinoza et al. (2011) found this shark to be a seasonal resident of the Full Tidal Basin of Bolsa Chica, California with higher abundance during summer months and a high proportion of immature individuals. Elkhorn Slough and Anaheim Bay, California have both been described as nursery areas for this species. In Elkhorn Slough, parturition occurs from January to May (Yudin 1987). In Anaheim Bay, mating reportedly occurs from February to June and parturition from March to June (Sandell 1973). In the Upper Gulf of California, mating and parturition is thought to occur from March to June and the region is considered a nursery area for this species (Prez-Jimnez 2006).

This species is live-bearing with a yolk sac placenta and litter sizes range between 3-16 pups (Talent 1985, Yudin 1987, Prez-Jimnez 2006, Ebert et al. 2013). Reproduction is annual and gestation takes about 10-12 months (Sandell 1973, Yudin 1987, Prez-Jimnez 2006). Data from central California indicates that males mature at 57-65 cm total length (TL; Yudin and Cailliet 1990), and data from the Northern Gulf of California suggests they mature at 72-74 cm TL (Prez-Jimnez 2006, Prez-Jimnez andSosa-Nishizaki2010). Females mature at 70-90 cm TL (Yudin and Cailliet 1990, Prez-Jimnez 2006,Prez-Jimnez andSosa-Nishizaki2010). The maximum recorded size for this species is 160 cm TL (Eschmeyer et al. 1983). Males mature between 1-2.5 years of age, females mature between 2-3 years of age, and the maximum observed lifespan is nine years (Yudin and Cailliet 1990, Prez-Jimnez 2006, Ebert et al. 2013). Size at birth is 20-30 cm (Sandell 1973, Talent 1985, Yudin 1987, Yudin and Cailliet 1990, Prez-Jimnez 2006). In the Northern Gulf of California, all young-of-the-year were found to be 49 cm TL or smaller. Average reproductive age is estimated at 4.6 years of age (Corts 2002).Generation length is estimated to be 11 years (Chen and Yuan 2006).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1.5 - 88
  Temperature range (°C): 10.343 - 16.549
  Nitrate (umol/L): 17.373 - 30.223
  Salinity (PPS): 33.613 - 34.816
  Oxygen (ml/l): 0.767 - 3.940
  Phosphate (umol/l): 1.439 - 2.132
  Silicate (umol/l): 18.051 - 21.239

Graphical representation

Depth range (m): 1.5 - 88

Temperature range (°C): 10.343 - 16.549

Nitrate (umol/L): 17.373 - 30.223

Salinity (PPS): 33.613 - 34.816

Oxygen (ml/l): 0.767 - 3.940

Phosphate (umol/l): 1.439 - 2.132

Silicate (umol/l): 18.051 - 21.239
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 200 m (Ref. 55308), usually 2 - 46 m (Ref. 55308)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1.5 - 88
  Temperature range (°C): 10.343 - 16.549
  Nitrate (umol/L): 17.373 - 30.223
  Salinity (PPS): 33.613 - 34.816
  Oxygen (ml/l): 0.767 - 3.940
  Phosphate (umol/l): 1.439 - 2.132
  Silicate (umol/l): 18.051 - 21.239

Graphical representation

Depth range (m): 1.5 - 88

Temperature range (°C): 10.343 - 16.549

Nitrate (umol/L): 17.373 - 30.223

Salinity (PPS): 33.613 - 34.816

Oxygen (ml/l): 0.767 - 3.940

Phosphate (umol/l): 1.439 - 2.132

Silicate (umol/l): 18.051 - 21.239
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild) Observations: Unverified estimates suggest these animals may live up to 12 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustelus californicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATTTTTGGTGCATGAGCAGGCATAGTTGGGACAGCTCTTAGCCTTCTAATTCGAGCCGAACTTGGGCAGCCAGGGTCACTCTTAGGTGATGATCAGATTTACAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTCTTTATGGTCATACCAATCATAATTGGAGGCTTTGGAAATTGACTGGTCCCCTTGATAATTGGTGCTCCAGACATAGCTTTCCCACGTATGAATAACATAAGCTTCTGACTCCTCCCACCATCATTTCTTCTTCTTCTTGCTTCTGCAGGAGTGGAAGCCGGTGCAGGCACCGGCTGAACAGTATATCCACCACTAGCTAGCAATCTAGCCCATGCTGGGCCATCTGTTGATTTAGCCATCTTCTCCCTTCATTTGGCCGGTATTTCATCAATCTTAGCCTCAATTAACTTTATTACGACTATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTCGTAACTACTATTCTCCTTCTTCTCTCCCTGCCAGTTCTTGCAGCAGGGATTACGATATTACTTACAGACCGAAACCTTAATACTACATTCTTTGACCCCGCAGGGGGAGGGGACCCAATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustelus californicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Prez-Jimnez, J., Vsquez, V.E., Chabot, C.L. & Ebert, D.A.

Reviewer/s
Nosal, A.P., Carlisle, A.B. & Cordova, J.

Contributor/s

Justification
Gray Smooth-hound (Mustelus californicus)ranges from Cape Mendocino, northern California to Mazatlan, Mexico in the southeastern Gulf of California, Eastern Central Pacific. It is demersal and usually occurs in shallow waters, from 8 m depth, but has been found offshore to depths of 265 m.This species is viviparous, with a yolk sac placenta. It is taken by recreational fishers and as bycatch off California and is both targeted and caught as bycatch in trawl and gillnet fisheries off Mexico. This is a relatively fast-growing smooth-hound, with a generation length of ten years, an early age at first maturity (2-3 years for females), and moderate fecundity (3-16 pups per litter). The majority of fishing pressure on this species occurs in the southern half of its range throughout the Gulf of California, with little fishing mortality reported in the United States. While no species-specific catch data are available from the northern Gulf of California, surveys from Baja California Sur suggest that the population of Gray Smooth-hound is stable in the region. Given this survey information and the life history characteristics of this species, Gray Smooth-hound is assessed as Least Concern. However,as fishing pressure is ongoing throughout much of this species' range, catch levels need to be quantified and catch and population trends should be monitored to ensure sustainability.

History
  • 2009
    Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

In the artisanal elasmobranch fishery of Baja California Sur, Mexico a ten-year survey (2000-2010) found Grey Smooth-houndto be most abundant during the summer and autumn seasons and distributed along the entire coast. While this shark, when identified to species-level, represented a low proportion of total annual catch recordsregardless of gear type (Gray Smooth-hound represented 192 out of 10,682 sharks caught), the general genus category ofMusteluswas by far the most well-represented of the total 455 undetermined elasmobranch species with 404 individuals listed under this genus.Morphological similarities among members of the genusMusteluscan lead to identification errors. Thus it should also be noted that during this survey a reported total catch of 78 individuals ofM. lunulatus were recorded, which is the species most similar in appearance to Gray Smooth-hound. In addition, one of the most commonly taken elasmobranchs (taken specifically by gill nets) was another species of related smooth-hound,M. henlei, with a total of 3,233 individuals caught (Ramirez-Amaroet al. 2013). Catches of Grey Smooth-hound over this ten-year survey period in Baja California Sur, Mexico were reported to be stable (Galvn-Magaa, 2015, pers. comm.).Within the official Mexican fisheries catch and fishing effort data, species-specific data are lacking for elasmobranchs (Prez-Jimnezand Sosa-Nishizaki2010). Currently, there are only three recognized elasmobranch categories: a) Sharks (sharks >150 cm total length (TL)); b) Cazones (sharks < 150 cm TL) and Rays (all batoids; Ramirez-Amaroet al. 2013).

Marquez-Farias (2000) reported that Gray Smooth-hound and other small shark species (Rhizoprionodon longurio,M. lunulatusandM. henlei) in Sonora state (northeastern Gulf of California) are sometimes caught in numbers as high as 1,200-1,500 individuals per fishing trip. In three regions of the Gulf of California (Southeastern, Central and Northern) the highest catches of Gray Smooth-houndobtained by a trawler vessel (operating at depths of 1-200 m) were: a) 51 kilograms per hour (kg/h-1)during February-March at depths of 41-80 m in the Southeastern Gulf of California (Sonora and Sinaloa coasts); b) 106.43 kg/ h-1during September at depths from 81-120 m in the Central Gulf of California (Midriff Islands) and; c) 186 kg/h-1during May at depths of 81-120 m in the Northern Gulf of California (Ehrhardtet al.1980). Although these authors state that these catches only includedM. californicus, they may alsohave includedM. lunulatusin shallower areas (from 1-80 m) andM. henleiin deeper areas (from 80-200 m). In Santa Rosalillita, Baja California (approximately 400 km south of Ensenada) 4,638 kg ofMustelusspecies were caught from May to September 2001 (Rodrguez-Medrano and Almeda-Jauregui 2002).



Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In the USA this species is regularly caught by recreational anglers in southern California and is of little economic value (Ebert 2003). The California Department of Fish and Wildlife reports <1 metric tonne of Grey Smooth-hound being landed by the commercial fisheries in 2013 (California Department of Fish and Wildlife, 2014).
The majority of the fishing pressure on Gray Smooth-hound occurs in Mexico, specifically in the Gulf of California. In Baja California,Mustelus species have been caught by the artisanal fishing fleet in the northern Gulf of California since the 1980s (Cudney and Turk 1998) and by the medium size trawl fleet since 1996, when 59 shrimp trawler vessels obtained fishing permits to catch finfish and elasmobranch species out of the shrimp fishing season. When they are not being targeted, they are taken as bycatch by the shrimp trawl fleet (Sustentabilidad y Pesca Responsible en Mxico: Evaluacin y manejo 1997-1998). No catch data are available but these trawl vessels operate in shallow waters where this species is present. In addition to trawl vessels, this species is frequently targeted with bottom gill-nets(4-6 inches mesh size)in the northern Gulf of California from March to July, especially when most valuable teleost species are not abundant. Neonates are not thought to be vulnerable to the gill-nets used because they are smaller than the mesh size (4, 6, 8 inches) in this area. In this region the catches can be as high as 500 kg per fishing trip. In the Baja California Sur, this species is commonly caught in the southern Gulf of California by medium size trawl vesselsthat target finfish and elasmobranchs from April to July (at depths shallower than 100 m), and is bycatch in the shrimp fishery from September to January (Prez-Jimnez 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific management measures in place for this species.

After the 2006 restoration of the Full Tidal Basin of Bolsa Chica, California, immature individuals of this species became seasonal residents (Espinoza et al. 2011). This shark utilizes the area by day for warm water temperatures then apparently forages at night (Espinoza et al. 2011). Though the area does not yet meet all the criteria for a nursery ground (Heupel et al. 2007), this wetland restoration project still appears to be of ecological importance to juveniles of this species (Espinoza et al.2011).

A set of national regulations, the Mexican Official Standard Rules for Shark and Ray responsible fisheries (NOM-029-PESC-2004-2006) entered into place in May 2007. These rules state that every individual kept aboard commercial shark fishery vessels must be used entirely, however, oceanic vessels may discard the shark guts and head and shark finning is prohibited. No information is available on how effectively these measures are enforced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grey smooth-hound

The grey smooth-hound (Mustelus californicus) is a houndshark of the family Triakidae,. It is found on the continental shelves of the subtropical eastern Pacific, from northern California to the Gulf of California, between latitudes 40° N and 23° N, from the surface to a depth of 200 m. It can grow up to a length of 1.24 m.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!