Overview

Comprehensive Description

Biology

Inhabits deep rocky runs and pools of small to medium rivers, usually among large rubble and boulders and rarely in riffles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Upper Roanoke River drainage, Virginia and North Carolina. Known in Roanoke proper and Dan systems from Ridge and Valley Province into upper half of Piedmont Province, where range is apparently discontinuous. Uncommon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Upper Raonoke River drainage in Virginia and North Carolina, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Roanoke River drainage, Virginia and North Carolina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 19 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 220 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

22.0 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Moxostoma ariommum
Catalog Number: USNM 162007
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Lachner & Handwerk
Year Collected: 1947
Locality: Va.: Montgomery Co., Roanoke River, 2.5 mi. S.W. of Shawsville, Roanoke Dr., Virginia, United States, North America
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Moxostoma ariommum
Catalog Number: USNM 165593
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Lachner & Handwerk
Year Collected: 1947
Locality: Va.: Montgomery Co., Roanoke R. 2.5 mi. S.W. of Shawsville, Montgomery County, Virginia, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Warm, generally clear to moderately turbid, moderate gradient, small to medium rivers. Larger juveniles and adults typically congregate in deep runs and heads of pools, usually among large rubble, boulders, and outcrop.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Warm, generally clear to moderately turbid, moderate gradient, small to medium rivers. Larger juveniles and adults typically congregate in deep runs and heads of pools, usually among large rubble, boulders, and outcrop.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats chironomid larvae, other immature insects, and water mites, based on sample of 8 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns apparently in March.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Moxostoma ariommum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTCGTATTTGGTGCCTGAGCCGGAATAGTAGGAACTGCCTTAAGCCTTCTAATTCGAGCCGAATTAAGTCAACCTGGGTCACTCCTCGGTGATGATCAAATTTATAATGTTATTGTTACCGCCCATGCCTTCGTTATAATTTTCTTTATAGTAATACCCATTTTAATTGGGGGATTTGGAAACTGACTTGTACCATTAATGATCGGAGCTCCTGACATAGCATTTCCCCGAATAAATAATATAAGTTTCTGACTACTACCTCCCTCTTTCCTGCTATTGTTAGCCTCTTCCGGGGTTGAGGCCGGAGCCGGAACAGGATGAACAGTATACCCGCCCCTCGCAGGCAATCTTGCTCATGCAGGAGCCTCTGTAGATCTCACCATTTTTTCTCTACACCTGGCAGGTGTTTCATCAATCCTTGGAGCAATTAATTTTATTACCACAACGATTAATATAAAACCCCCAGCCATCTCTCAATATCAAACACCCCTGTTCGTATGAGCTGTTCTTGTAACAGCTGTTCTTCTTCTCTTATCACTACCTGTCCTAGCTGCAGGTATTACCATGCTCTTAACAGACCGAAATTTAAATACAACATTCTTTGACCCGGCAGGAGGAGGAGACCCAATTCTCTATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Moxostoma ariommum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Small range in the upper Roanoke River drainage, North Carolina and Virginia; uncommon, but currently stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely to be relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).

History
  • 1996
    Data Deficient
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Currently stable (Warren et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Currently stable (Warren et al. 2000).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No major threats exist at the present time. Potential threats include creation of recreation impoundments (fish needs flowing water), siltation/runoff from nonpoint agricultural/domestic sources, and habitat fragmentation from multiple sources (P. Angermeier, F. Rohde, pers. comm., 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats exist at the present time. Potential threats include creation of recreation impoundments (fish needs flowing water), siltation/runoff from nonpoint agricultural/domestic sources, and habitat fragmentation from multiple sources (P. Angermeier and F. Rohde pers. comm. 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research actions.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bigeye Jumprock

The Bigeye Jumprock (Scartomyzon ariommus) is a species of ray-finned fish in the Catostomidae family. It is found only in the upper Roanoke River drainage in Virginia and North Carolina, United States. It inhabits deep rocky runs and pools with large boulders and rubble. It reaches a maximum length of around 22 cm.

Source[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species is morphologically and genetically very distinct from other species that generally have been placed in the genus Moxostoma (see Lee et al. 1980).

Scartomyzon was for many years regarded as a subgenus of the genus Moxostoma. Smith (1992) raised Scartomyzon to full genus status, but he noted the problematical generic allocation of "Scartomyzon ariommus." Harris and Mayden (2001) used molecular data to examine phylogenetic relationships of major clades of Catostomidae. In all trees, Scartomyzon was paraphyletic and embedded in Moxostoma, and Catostomus was never recovered as monophyletic (Xyrauchen was embedded within Catostomus). They concluded that the phylogenetic relationships and taxonomic composition of taxa presently included in Moxostoma and Scartomyzon are in need of further study, as are the relationships and composition of the genera Catostomus, Chasmistes, Deltistes, and Xyrauchen, and the phylogenetic affinites of Erimyzon and Minytrema. Based on molecular data, Harris et al. (2002) recommended that Scartomyzon be subsumed into Moxostoma. Nelson et al. (2004) concurred and included in the genus Moxostoma all species that Smith (1992) had assigned to the genus Scartomyzon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!