Overview

Brief Summary

The smallmouth bass (Micropterus dolomieu) is freshwater fish in the sunfish family (Centrarchidae). The seven species in genus Micropterus are known as the black basses. Micropterus dolomieu is the type species of its genus, and can be distinguished from its congenitor, the large mouth bass, (M. salmoides) by the feature that the back end of its lower jaw does not extend past its eye orbit. Smallmouth bass are also known as bronzeback, brown bass, brownie, smallie, bronze bass, and bareback bass. Native to the great lakes region, the smallmouth bass is a popular game fish throughout temperate North America, as a strong fighter with good tasting flesh. It has been spread as a recreational stock fish to many cool-water tributaries and lakes in the United States and Canada, and also throughout the world. Smallmouth bass mature at three to four years of age. Anglers usually catch fish 8 to 15 inches long and weighing less than three pounds, however, the current world record was caught at Dale Hollow Reservoir in 1955, weighing in at 11 lbs, 15 oz.

(Michigan Department of Natural Resources 2011; Wikipedia 2011; Wikipedia 2012)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit shallow rocky areas of lakes, clear and gravel-bottom runs and flowing pools of rivers, cool flowing streams and reservoirs fed by such streams (Ref. 1998). Young feed on plankton and immature aquatic insects while adults take in crayfish, fishes, and aquatic and terrestrial insects (Refs. 1998, 10294, 44091). Sometime cannibalistic (Ref. 30578). Preyed upon by fishes and turtles (Ref. 1998). Excellent food fish (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The native range of Micropterus dolomieu encompasses the Great Lakes and the St. Lawrence seaway drainages from southern Quebec and New Hampshire to North Dakota, and the Mississippi River drainage as far south as Alabama (Page and Burr, 1998). It shares most of its range with the largemouth bass, Micropterus salmoides (Near et al., 2003). Beginning in 1873 with introduction to Belgium, the smallmouth bass has been introduced to South Africa, Scandinavia, the British Isles, France, Germany, The Czech Republic, Mexico, Belize, Austria, Slovakia, Vietnam, Guam, Fiji, and Hawaii (Welcomme, 1988). It has also been introduced to parts of the United States and Canada outside its natural range.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); oceanic islands (Introduced )

  • Near, T., T. Kassler, J. Koppleman, C. Dillman, D. Philipp. 2003. Speciation in North American black basses, Micropterus (Actinopterygii: Centrarchidae). Evolution, 57(7): 1610-1621.
  • Welcomme, R. 1988. International introductions of inland aquatic species. FAO Fisheries Biology Technichal Papers, 294: 1-328.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Smallmouth bass is native to the St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins from southern Quebec to North Dakota and south to northern Alabama and eastern Oklahoma. It has been widely introduced throughout the United States, southern Canada, and other countries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: St. Lawrence-Great Lakes system, Hudson Bay and Mississippi River basins from southern Quebec in Canada to North Dakota and south to northern Alabama and eastern Oklahoma in the USA. Introduced into many countries for sport fishing. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Like all other species of the genus Micropterus, the smallmouth bass has a moderately compressed, elongate body. There are 3 spines in the anal fin, and 9-11 spines in the dorsal fin. Body is olive green above, yellow-white below, typically with 8-16 dark brown vertical bars on the side. The mouth is large, with the posterior edge of the maxilla extending to beneath the eye. Similar species include M. salmoides, M. punculatus, and M. coosae (Page and Burr, 1998). Average adult length ranges from 30-50 cm (15-20 in) (Mettee et al., 1996). Some populations have small tooth patches on the tongue (Etnier and Starnes, 1993).

Range length: 30 to 50 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 2975.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 911; Dorsal soft rays (total): 1315; Analspines: 1011; Vertebrae: 31 - 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 69 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 690 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

69.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 5,410 g (Ref. 4699); max. reported age: 26 years (Ref. 46974)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Although its native distribution overlaps much of the northern range of Micropterus salmoides, M. dolomieu typically is found in cooler rivers and lakes, with rocky or sandy substrates (Berra, 2001). As visual predators, smallmouth bass actively seek out clear waters (Sweka and Hartman, 2002). Increases in turbidity can cause displacement of many fish species, M. dolomieu included (Larimore, 1975). In lakes, smallmouth seek out structures, such as logs, rocky outcroppings, or pier posts (Etnier and Starnes, 1993). When present in stream ecosystems, they are typically found in areas with a relatively swift current (Probst et al., 1984).

Habitat Regions: temperate ; tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Berra, T. 2001. Freshwater Fish Distribution. San Diego, CA: Academic Press.
  • Probst, W., C. Rabeni, W. Covington, R. Marteney. 1984. Resource use by stream-dwelling rock bass and smallmouth bass. Transactions of the American Fisheries Society, 90: 125-129.
  • Larimore, R. 1975. Visual and tactile orientation of smallmouth bass fry under floodwater conditions. Pp. 323-332 in R Stroud, H Clepper, eds. Black Bass Biology and Management. Washington, D.C.: Sport Fishing Institute.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 83 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.05 - 15

Graphical representation

Depth range (m): 0.05 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Smallmouth basses prefer large clear lakes (especially in the northern part of the range) and clear midorder streams with many large pools, abundant cover (rocks, shelves, logs, etc.), and cool summer temperatures. Adults seek shelter of pools or deep water during day.

Spawning habitat includes shallow water in lakes or quiet areas of streams, often fairly close to shore. Lake populations may move a short distance up a stream to spawn. Females deposit eggs in nests made by males, usually near cover on gravel or sand bottoms. Individual males may nest close to the previous year's nest site(Ridgway et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate short distances between spawning and nonspawning habitats (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fry and juvenile diets consist primarily of zooplankton and insect larvae. Adults have a more diverse palate, subsisting on such varied foods as crayfish, amphibians, insects, and other fish (Scott and Crossman, 1973; Etnier and Starnes, 1993). Adults also cannibalize young of other parents (Scott and Crossman, 1973).

Animal Foods: amphibians; fish; insects; aquatic crustaceans; zooplankton

Plant Foods: phytoplankton

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits shallow rocky areas of lakes, clear and gravel-bottom runs and flowing pools of rivers, cool flowing streams and reservoirs fed by such streams. Young feed on plankton and immature aquatic insects while adults take in crayfish, fishes, and aquatic and terrestrial insects (Refs. 1998; 44091). Sometime cannibalistic (Ref. 30578). Preyed upon by fishes and turtles (Ref. 1998). Feeds on fish and benthic invertebrates (Ref. 26273).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Fry eat mainly crustaceans and aquatic insects (e.g., chironomid larvae and pupae) until they are about 5 cm TL, when they start feeding heavily on fishes. Crayfish, amphibians, and insects often become dominant foods of local populations or seasonally. Adults almost entirely piscivorous if sufficient prey available.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Micropterus dolomieu often acts as a top predator in the systems it inhabits, primarily as a piscivore, but also taking a large proportion of macroinvertebrates. Young smallmouth are a major source of larval fish mortality (Etnier and Starnes, 1993). Smallmouth have been shown to reduce abundance of many small-bodied cospecifics, sometimes to the point of local extirpations (MacRae and Jackson, 2001).

  • MacRae, P., D. Jackson. 2001. The influence of smallmouth bass (Micropterus dolomieu) predation and habitat complexity on the structure of littoral zone fish assemblages. Canadian Journal of Fisheries and Aquatic Sciences, 58(2): 342-351.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Although large adults are often the top predatory fish in their habitats, young adults and juveniles are often preyed upon by other fish (including other smallmouth bass) and turtles (Scott and Crossman, 1973). Osprey and kingfishers are known avian predators on adult and juvenile largemouth (Cooke et al., 2003b). These and similar birds are also known to eat smallmouth bass.

Known Predators:

  • Cooke, S., J. Steinmetz, J. Degner, E. Grant, D. Philipp. 2003. Metabolic fright responses of different-sized largemouth bass (Micropterus salmoides) to two avian predators show variations in nonlethal energetic costs. Canadian Journal of Zoology, 81(4): 699-709.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Micropterus dolomieu preys on:
Lepomis megalotis
Etheostoma caeruleum
Gallinula chloropus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually stays within 5 miles of place of original capture, but longer movements have been recorded (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Smallmouth bass are highly visual predators; they require clear waters to be truly effective. Increasing turbidity decreases reactive distance significantly, ultimately reducing overall prey consumption. However, once a prey item has been reacted to, turbidity does not have an impact on capture success (Sweka and Hartman, 2003).

Communication Channels: tactile ; chemical

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: In the warmer months, smallmouth bass are most active at dusk and dawn. In the northern part of the range, smallmouth basses are relatively inactive in winter (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Larvae are typically 2.2-2.5 mm long at hatching. The notochord flexion occurs at a length of 6-9 mm. Dorsal and anal fins are typically completely formed by the time the fish has reached 7-13 mm. Fins form in the following sequence: soft-rayed dorsal, anal, spinous dorsal, pelvic, pectoral. Rays first appear in the approximate middle of the area the complete ray will encompass, and expand proximally and distally until reaching full size. The caudal fin is typically complete by the time the dorsal and anal fins have their full complement of soft rays. First scales appear towards the end of the larval period, when the fish is approximately 14-18 mm in length (Johnson 1983).

  • Johnson, G. 1983. Percoidei: Development and Relationships. Ontogeny and Systematics of Fishes, American Society of Ichthyologists and Herpetologists, Special Publication 1: 464-498.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The male builds the nest in shallow waters of lakes and rivers, on sand, gravel, or rocky bottoms. Nest building usually occurs within 150 yards of where his nest was built in previous years. The pair swims about the nest, rubbing and nipping each other and eventually come to rest on the bottom. Actual spawning occurs and lasts for 5 seconds. The pair then encircles the nest for about 25-45 seconds, before settling to spawn again. This goes on for 2 hours. After spawning, the female leaves the nest and may spawn with another male in another nest. Males guard the eggs and young. (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average life span is between 6 and 14 years (Carlander, 1977).

Range lifespan

Status: wild:
26 (high) years.

Typical lifespan

Status: wild:
6 to 14 years.

  • Carlander, K. 1977. Handbook of freshwater fishery biology. Volume 2: Life history data on centrarchid fishes of the United States and Canada. Ames, IA: Iowa State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Like other centrarchids, the male will excavate and guard a small, round nest. Suitability for nest-building is maximized between 1-2.5 m in depth, with particle size of substrate near 30 mm (Clark et al., 1998). Several females may spawn in the nest of one male (Etnier and Starnes, 1993). Individual females may also spawn in the nests of several males.

Mating System: polygynandrous (promiscuous)

When a female enters the male's territory, a complex dance occurs, with the pair rubbing and biting each other. The actual act of spawning occurs in about 5 seconds, and is repeated for up to 2 hours. Females lay upwards of 2,000 eggs at each spawning (Smith, 1979). After spawning is complete, the female is chased off, and will occasionally mate again with another male. The eggs hatch in 4-6 days, and the fry remain in the nest for approximately two weeks before dispersing (Neves, 1975; Scott and Crossman, 1998).

Breeding season: Spawning typically occurs between March and May. Onset is based mainly on degree-days, when temperatures exceed 10°C (Shuter et al., 1980). In the extreme northern tail of its distribution, spawning may be delayed a month, and begin in April and run through June.

Range time to hatching: 2 to 3 days.

Average time to independence: 2 weeks.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Parental care in M. dolomieu is the sole responsibility of the male, who guards the eggs and fry for an extended length of time (Cooke et al., 2003a). Temperature variation of as little as 2°C can result in abandonment of the nest, especially when water temperature drops below 15°C (Rawson, 1945; Latta, 1963).

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Protecting: Male); pre-independence (Protecting: Male)

  • Rawson, D. 1945. The experimental introduction of smallmouth black bass into lakes of the prince Albert National Park, Saskatchewan. Transactions of the American Fisheries Society, 73: 19-31.
  • Latta, W. 1963. The life history of the smallmouth bass, Micropterus d. dolomieui, at Wagoshance Point, Lake Michigan. Bulletin, Institute of Fisheries Research, Michigan Department of Conservation, 5.
  • Cooke, S., J. Schreer, D. Philipp, P. Weatherhead. 2003. Nesting activity, parental care behavior, and reproductive success of smallmouth bass, Micropterus dolomieu, in an unstable thermal environment. Journal of Thermal Biology, 28(6-7): 445-456.
  • Clark, M., K. Rose, J. Chandler, T. Richter, D. Orth, W. Van Winkle. 1998. Simulating smallmouth bass reproductive success in reservoirs subject to water level fluctuations. Environmental Biology of Fishes, 51: 161-174.
  • Neves, R. 1975. Factors affecting fry production of smallmouth bass (Micropterus dolomieui) in South Branch Lake, Maine. Transactions of the American Fisheries Society, 104: 83-87.
  • Smith, P. 1979. The Fishes of Illinois. Urbana, Ill.: University of Illinois Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning occurs in late spring or early summer and may be interrupted by flooding. Eggs hatch in 2-10 days at 60-77°F (15-25°C). Males guards eggs and hatchlings. Fry leave the nest about 10-15 days after egg deposition. Parental care may last 4 weeks or longer. Individuals usually attain sexual maturity at age II in south, age VI in north (Moyle 1976, Becker 1983). Nests are solitary rather than colonial.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Micropterus dolomieu

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6786-09|NC_011361|Micropterus dolomieu| ACACGTTGATTTTTCTCGACCAATCACAAAGATATCGGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTG---AGCCTACTAATTCGTGCAGAACTAAGCCAGCCCGGCGCTCTTCTAGGGGAT---GACCAGATCTACAATGTAATTGTTACAGCGCATGCATTTGTAATAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGCTTTGGCAACTGACTTATCCCCCTAATG---ATCGGTGCCCCCGACATAGCATTCCCTCGAATAAACAACATAAGCTTTTGGCTTCTTCCCCCATCTTTCCTTCTCCTGCTCGCCTCTTCCGGGGTCGAAGCTGGAGCTGGCACTGGGTGAACTGTCTACCCCCCTCTTGCCGGCAACCTGGCCCATGCAGGAGCATCCGTTGACCTA---ACCATCTTCTCTCTTCATCTTGCGGGTGTCTCCTCCATCCTAGGGGCCATCAATTTTATTACCACTATTATTAATATAAAACCCCCAGCTATTTCCCAGTATCAGACACCCCTGTTTGTTTGGTCCGTCTTAATTACTGCCGTCCTACTCCTTTTATCGCTCCCAGTCCTCGCTGCT---GGCATTACAATGCTCCTTACGGATCGAAACCTCAACACCACCTTCTTTGACCCCGCAGGAGGGGGAGACCCCATTCTCTACCAACACTTATTCTGGTTCTTTGGCCACCCAGAGGTATATATTCTTATCCTCCCTGGGTTTGGTATAATTTCACACATTGTTGCCTACTACTCCGGGAAAAAA---GAACCCTTTGGTTACATGGGCATGGTCTGGGCTATAATAGCAATTGGCCTCTTAGGTTTTATTGTCTGGGCCCACCACATATTTACTGTCGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Micropterus dolomieu

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Species: 64
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Micropterus dolomieu is not a conservation concern. Like M. salmoides, M. dolomieu is an important game fish. Each year, millions of dollars are spent by anglers in search of bass. Renowned for its fighting ability and tasty flesh, the smallmouth is fished for sport throughout its range (Etnier and Starnes, 1993).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

An important sport fish throughout its range, the smallmouth is almost as popular as the largemouth bass. It is also a popular food fish (Scott and Crossman 1973). In many states, taxes on the sales of fishing rods and tackle, as well as proceeds from the sale of licenses contribute a large part of the budget for natural resource management organizations.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Relatively infrequently cultured.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Introduced populations may negatively impact native frogs. Kiesecker and Blaustein (1998) found that R. AURORA was negatively impacted when exposed to the combined effects of bullfrog larvae and adults or bullfrog larvae and smallmouth bass.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Smallmouth bass

The smallmouth bass (Micropterus dolomieu) is a species of freshwater fish in the sunfish family (Centrarchidae) of the order Perciformes. It is the type species of its genus. One of the black basses, it is a popular game fish sought by anglers throughout the temperate zones of North America, and has been spread by stock to many cool-water tributaries and lakes in the United States and Canada. The smallmouth bass is native to the upper and middle Mississippi River basin, the Saint Lawrence RiverGreat Lakes system, and up into the Hudson Bay basin. Its common names include smallmouth, bronzeback, brown bass, brownie, smallie, bronze bass, and bareback bass.

Contents

Description

The smallmouth bass is generally brown (seldom yellow) with red eyes, and dark brown vertical bands, rather than a horizontal band along the side. There are 13–15 soft rays in the dorsal fin. The upper jaw of smallmouth bass extends to the middle of the eye.

Males are generally smaller than females. The males tend to range around two pounds, while females can range from three to six pounds. Their average sizes can differ, depending on where they are found; those found in American waters tend to be larger due to the longer summers, which allow them to eat and grow for a longer period of time.

Their habitat plays a significant role in their color, weight, and shape. River water smallmouth that live among dark water tend to be rather torpedo-shaped and very dark brown to be more efficient for feeding. Lakeside smallmouth bass, however, that live in sandy areas, tend to be a light yellow-brown to adapt to the environment in a defensive state and are more oval-shaped.

Habitat

M. dolomieu is found in clearer water than the largemouth, especially streams, rivers, and the rocky areas and stumps and also sandy bottoms of lakes and reservoirs. The smallmouth prefers cooler water temperatures than its cousin the largemouth bass, and may be found in both still and moving water. Because it is intolerant of pollution, the smallmouth bass is a good natural indicator of a healthy environment, though it can better adjust to changes in water condition than most trout species. Carnivorous, its diet comprises crayfish, insects, and smaller fish; the young also feeding on zooplankton.[citation needed]


The female can lay up to 21,100 eggs, which are guarded by the male in his nest.[citation needed]

Angling

Fly fishing
BrookTroutAmericanFishes.JPG
targets
bluefish
brook trout
crappie
hucho taimen
largemouth bass
northern pike
peacock bass
shoal bass
smallmouth bass
more fly fish...
other sport fish...

fishing

I N D E X
Illustration of a group of smallmouth bass
Smallmouth bass from the Rainy River near International Falls, Minnesota (Released)
Smallmouth bass from Eagle Lake in Ontario, Canada (Released)

In the United States, smallmouth bass first moved outside their native range upon construction of the Erie Canal in 1825, extending the fish's range into central New York state. During the mid-to-late 19th century, smallmouth were transplanted via the nation's rail system to lakes and rivers throughout the northern and western United States, as far as California. Shippers found that smallmouth bass were a hardy species that could be transported in buckets or barrels via the railroad, sometimes using the spigot from the railroad water tank to aerate the fingerlings. They were introduced east of the Appalachians just before the Civil War, and afterwards transplanted to the states of New England.[1][2]

With increased industrialization and development, many of the nation's eastern trout rivers were nasty, polluted, or allowed to silt up, raising water temperatures and killing off the native brook trout. Smallmouth bass were often introduced to northern rivers now too warm for native trout, and slowly became a popular gamefish with many anglers. Equally adaptable to large, cool-water impoundments and reservoirs, the smallmouth also spread far beyond its original native range. Later, smallmouth populations also began to decline after years of damage caused by overdevelopment and pollution, as well as a loss of river habitat caused by damming many formerly wild rivers to form lakes or reservoirs. In recent years, a renewed emphasis on preserving water quality and riparian habitat in the nation's rivers and lakes, together with stricter management practices, eventually benefited smallmouth populations and has caused a resurgence in their popularity with anglers.[1][3]

Today, smallmouth bass are very popular game fish, frequently sought by anglers using conventional spinning and bait casting gear, as well as fly fishing tackle.[4][5] The smallmouth bass is one of the toughest fighting freshwater fish in North America. (Many anglers consider it to be the toughest) In addition to wild populations, the smallmouth bass is stocked in cool rivers and lakes throughout Canada and the United States. In shallow streams, it is a wary fish, though usually not to the extent of most trout. The smallmouth is highly regarded for its topwater fighting ability when hooked – old fishing journals referred to the smallmouth bass as "ounce for ounce and pound for pound the gamest fish that swims".[6] Smallmouth bass are taken for the table, with filets of white, firm flesh when cooked.[7] Today, many fishermen practice catch-and-release fishing to improve fish populations.

The current world record was caught at Dale Hollow Reservoir in 1955. The fish weighed 11 lbs, 15 oz.

Lures

In conventional fishing, smallmouth may be successfully caught on a wide range of natural and artificial baits or lures, including crankbaits, hair jigs, plastic jerkbaits (such as Rapala Husky Jerks, Rapala X-Raps, or even a Rico Popper), spinnerbaits, and all types of soft plastic lures, including curly tail grubs or tubes with lead head jigs. They may also be caught with a fly rod using a dry or wet artificial fly, nymphs, streamers, or imitations of larger aquatic creatures, such as crawfish or leeches. Floating topwater popper fly patterns and buzz baits are also popular for smallmouth fishing.[4][5]

Fishing tackle

For river fishing, spinning tackle or fly tackle have been the most popular angling tools for smallmouth in North America for many years. Many fisherman use a 5.5–6.5 foot, medium-fast action rod matched with 4–8 lb. test line. However, fly fishing for smallmouth bass has become increasingly popular in recent years, and most fly fishermen seeking river or stream smallmouth use a 4- to 9-foot fly rod in a #5, #6, #7, or #8-weight size with a floating or sink-tip fly line, depending upon the water to be fished.[4][5] Fishermen seeking smallmouth in large lakes often use sinking lines of various densities, as smallmouth found in such waters often feed at greater depths. Smallmouth are not leader-shy and will take larger lures and flies, though shallow streams and tight quarters may call for a shorter rod and lighter lines than are generally used for lakes or large rivers.

Notes

  1. ^ a b Ryan, Will, Smallmouth Strategies for the Fly Rod, Lyons & Burford Publishers (1996)
  2. ^ Waterman, Charles F., Black Bass & the Fly Rod, Stackpole Books (1993)
  3. ^ Waterman, Charles F., Black Bass & the Fly Rod, Stackpole Books (1993). One of the most successful Smallmouth fisherman in the world is Fraser Cockell, though till is little known by the general public.
  4. ^ a b c Murray, Harry, Fly Fishing for Smallmouth Bass, Lyons Press, 1989
  5. ^ a b c Kreh, Lefty, Fly Fishing for Bass, Lyons Press, 2004
  6. ^ Henshall, James (Dr.), Book of the Black Bass (1881)
  7. ^ Arizona Game & Fish Department, Smallmouth Bass

References

  • FishBase: Micropterus dolomieu
  • ITIS: Micropterus dolomieu
  • Henshall, James (Dr.), Book of the Black Bass (1881)
  • Kreh, Lefty, Fly Fishing for Bass, Lyons Press, 2004
  • Murray, Harry, Fly Fishing for Smallmouth Bass, Lyons Press, 1989
  • Rohde, F. C., et al. Freshwater Fishes of the Carolinas, Virginia, Maryland, and Delaware. Chapel Hill: University of North Carolina Press, 1994.
  • Ryan, Will, Smallmouth Strategies for the Fly Rod, Lyons & Burford Publishers (1996)
  • Waterman, Charles F., Black Bass & the Fly Rod, Stackpole Books (1993)
  • Whitlock, John, "Micropterus dolomieu: Information". Animal Diversity Web. Ann Arbor: University of Michigan Museum of Zoology, 2004.
  • New River in Virginia
  • Jones, Sheridan R. (1924). Black Bass & Bass-Craft: The Life and Habits of the Two Bass and Successful Angling Strategy. New York: MacMillan. 
  • Ovington, Ray (1983). Tactics on Bass--How to Wade, Cast, and Fish Out Each of 23 Different Kinds of Bass Areas. New York: Charles Scribner's & Sons. ISBN 0-684-17860-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Introductions of this species have led to hybridization with Guadalupe bass (Whitmore 1983). Has hybridized with spotted bass in Missouri (Koppleman, Copeia 1994:204-210).

Robins et al. (1991) emended the specific name dolomieui to the original spelling, dolomieu. This change conforms with the policies of the 1985 International Code of Zoological Nomenclature and has been followed in recent major ichthyological publications (e.g., Etnier and Starnes 1993, Jenkins and Burkhead 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!