Overview

Comprehensive Description

Biology

Inhabits rocky runs and pools of creeks and small to medium rivers (Ref. 205); also found in upland streams (Ref. 10294). Oviparous (Ref. 205).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Native to Alabama, Chattahoochee, Coosa, Savannah, and Warrior river systems, above Fall Line, in Alabama, Georgia, South Carolina, North Carolina, and Tennessee. Introduced in Altamaha River, Georgia; Sisquoc River, California; Puerto Rico; Arkansas; upper Cumberland River drainage, Kentucky, and elsewhere below Fall Line in southeastern U.S. (Lee et al. 1980, Page and Burr 1991). Common, especially in upper Alabama River system (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Alabama, Chattahoochee, Coosa, Savannah, and Warrior river systems, above Fall Line, in Alabama, Georgia, South Carolina, North Carolina, and Tennessee. Introduced in Altamaha River, Georgia; Sisquoc River, California; Puerto Rico; Arkansas; upper Cumberland River drainage, Kentucky, and elsewhere below Fall Line in southeastern U.S. (Lee et al. 1980, Page and Burr 1991). Common, especially in upper Alabama River system (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Savannah, Chattahoochee and Mobile Bay basins in North Carolina, South Carolina, Georgia, Tennessee and Alabama in the USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern U.S.A., establshhed in California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 10 - 11
  • Baker, W.H., R.E. Blanton and C.E. Johnston 2013 Diversity within the redeye bass, Micropterus coosae (Perciformes: Centrarchidae) species group, with descriptions of four new species. Zootaxa 3635(4):379-401. (Ref. 93229)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 39 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 470 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

47.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 3,710 g (Ref. 4699); max. reported age: 10 years (Ref. 72462)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A member of Micropterus coosae species group but differs from all other members of the group by having red on the distal one-half of second-dorsal, caudal, and anal fins, and entire length of pectoral-fin rays (vs. green, yellow-green, or orange on smaller portions of fins in other species) and midline row of blotches partial to lacking, typically with 6 or fewer anterior vertical blotches with the remainder too diffuse to recognize as blotches or spots (in 76% of individuals; remaining 24% with midline row of blotches extending total body length, having 10-13 blotches). It further differs from M. tallapoosae and M. chattahoochae by a combination of the following characters: smaller scales (2.6 vs. 2.9% SL); higher scale counts, including lateral-line scales (mode 70 vs. 65 or 66; range 68-73 in 83.8% vs. 61-67 in 77.2%), and scale rows around caudal peduncle (mode = 30 vs. 29; range 30-32 in 80.0% vs. 26-29 in 94.1%). It can be further separated from M. warriorensis by the presence of a tooth patch (vs. absent; from M. tallapoosae, M. warriorensis, M. cahabae, M. chattahoochae, and M. cf. coosae (Savannah River) by a narrower postfrontal width 11.0% SL (vs. 11.2% SL or more); and from M. cahabae by the presence of more pronounced white tips on the caudal fin (Ref. 93229).
  • Baker, W.H., R.E. Blanton and C.E. Johnston 2013 Diversity within the redeye bass, Micropterus coosae (Perciformes: Centrarchidae) species group, with descriptions of four new species. Zootaxa 3635(4):379-401. (Ref. 93229)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Micropterus coosae
Catalog Number: USNM 73542
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Tower
Year Collected: 1897
Locality: Little R. On Lookout Mt., Rome, Ga., Georgia, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Micropterus coosae
Catalog Number: USNM 101076
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): H. Jolly
Year Collected: 1935
Locality: Top of Lookout Mtn. Ga., Georgia, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Micropterus coosae
Catalog Number: USNM 31152
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & A. Brayton
Locality: Etowah R., Georgia, United States, North America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Clear upland creeks and small to medium rivers, in rocky runs and pools. Moves up into small tributary streams or the heads of pools in larger streams to spawn (Moyle 1976).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Clear upland creeks and small to medium rivers, in rocky runs and pools. Moves up into small tributary streams or the heads of pools in larger streams to spawn (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic feeder; relies heavily on terrestrial insects. Also consumes aquatic insects, fishes, fish eggs, crayfish, and salamanders (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Contracaecum Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Breed in shallow ponds, lakes or creeks (Ref. 205). Distinct pairing (Ref. 205). Oviparous (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in late spring when temperatures rise to 17-21 C; sexually mature presumably in 2-4 years; spawning behavior similar to smallmouth bass (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Micropterus coosae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTGAGCCTGCTAATCCGTGCAGAACTTAGCCAACCGGGCGCTCTTCTAGGAGATGACCAAATCTACAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCCATCATAATTGGAGGCTTTGGCAACTGACTTATCCCCCTAATGATCGGTGCCCCCGACATGGCGTTCCCTCGAATAAACAACATAAGCTTTTGACTCCTTCCCCCTTCCTTCCTTCTCCTGCTCGCCTCTTCCGGGGTCGAGGCCGGAGCTGGCACTGGGTGGACTGTTTATCCCCCTCTTGCCGGCAACCTAGCCCATGCAGGAGCATCCGTTGACCTAACCATCTTCTCTCTTCATCTCGCAGGTGTCTCTTCTATCCTAGGCGCCATCAATTTTATTACCACAATCATTAATATAAAACCCCCAGCCATCTCCCAGTACCAAACACCCCTCTTTGTCTGATCCGTCCTAATTACTGCCGTCCTGCTCCTTCTATCACTCCCAGTCCTCGCCGCAGGCATTACGATGCTCCTTACGGACCGAAACCTTAACACCACCTTCTTTGACCCCGCAGGAGGAGGGGACCCTATTCTTTACCAACANNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Micropterus coosae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Redeye bass

The Redeye bass (Micropterus coosae) is a species of freshwater fish in the sunfish family (Centrarchidae) native to the Coosa River system of Georgia, Alabama. The waters it is normally found in are cool streams and rivers in the foothills of mountains.

Systematics[edit]

In 2013, M. coosae was split into five species with M. coosae restricted to the Coosa River system. M. cahabae of the Cahaba River system, M. chattahoochae of the Chattahoochee River system, M. tallapoosae of the Tallapoosa River system and M. warriorensis of the Black Warrior River system were all recognized as separate species.[2]

Description[edit]

The upper jaw (maxilla) extends to the back of the eye, which is usually red. There are dark bars on the side, which fade to lighter color in the center.

Growing to a maximum reported overall length of 47 cm (19 in), the redeye bass is one of the smaller black basses. The probable world record for Redeye bass is 5 lb 2.5 oz (2.34 kg) from Lake Jocassee in South Carolina.[3] Many Redeye bass world record listings, especially those over 5 lb (2.3 kg) are actually records for the shoal bass (Micropterus cataractae) which was commonly called Redeye bass.

Fly rod caught Redeye Bass, Tallapoosa River, Tallassee, Alabama (Released)

Its main food tends to be insects.

The rock bass (Ambloplites rupestris), a distinct species of Centrarchid, is sometimes called the redeye or redeye bass in Canada.

References[edit]

Notes[edit]

  1. ^ NatureServe (2013). "Micropterus coosae". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 12 June 2014. 
  2. ^ Baker, W.H., Blanton, R.E. & Johnston, C.E. (2013). "Diversity within the Redeye Bass, Micropterus coosae (Perciformes: Centrarchidae) species group, with descriptions of four new species". Zootaxa (Magnolia Press) 3635 (4): 379–401. doi:10.11646/zootaxa.3635.4.3. 
  3. ^ "Westminster Angler Breaks State Redeye Bass Record". South Carolina Department of Natural Resources. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some authors regard this species as conspecific with the undescribed "shoal bass" of the Apalachicola drainage (e.g., Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!