You are viewing this Species as classified by:

Overview

Comprehensive Description

Biology

A solitary species (Ref. 26340) inhabiting rocky and reef areas.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda, southern Florida (USA) and Bahamas to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 67; Dorsal soft rays (total): 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 90 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout relatively long; yellow band from tip of snout and chin to eye.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 30 - 60 m (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 24 - 512.4
  Temperature range (°C): 11.554 - 11.554
  Nitrate (umol/L): 20.595 - 20.595
  Salinity (PPS): 35.391 - 35.391
  Oxygen (ml/l): 3.134 - 3.134
  Phosphate (umol/l): 1.283 - 1.283
  Silicate (umol/l): 10.966 - 10.966

Graphical representation

Depth range (m): 24 - 512.4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 30 - 60m.
From 30 to 60 meters.

Habitat: reef-associated. Inhabits deep recesses of rocky reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Liopropoma mowbrayi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTTCTGATTCGAGCCGAACTTAGCCAACCAGGGGCCCTCCTCGGAGACGACCAAATCTATAACGTAATTGTTACAGCTCACGCCTTTGTAATAATTTTCTTTATAGTGATACCAATCATGATTGGTGGCTTTGGCAATTGACTTATTCCACTAATGATTGGAGCCCCAGACATGGCTTTCCCTCGGATAAACAACATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTTCTTCTTCTCGCTTCTTCAGGCGTAGAAGCTGGGGCCGGTACCGGCTGAACCGTTTACCCCCCTCTAGCAGGCAATCTAGCCCATGCAGGAGCATCCGTCGACCTAACGATCTTCTCACTACACCTCGCAGGTATTTCGTCAATCCTCGGAGCAATCAACTTCATCACAACCATTATTAACATAAAACCCCCCGCAGTCTCCCAGTATCAGACACCTCTCTTCGTATGAGCTGTCCTAATTACTGCTGTGCTTCTCCTACTCTCACTACCAGTTTTAGCCGCCGGCATCACAATACTACTAACGGACCGTAATCTTAATACTTCTTTCTTTGACCCAGCAGGAGGTGGAGACCCAATTCTGTACCAGCATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Liopropoma mowbrayi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!