Overview

Comprehensive Description

Biology

Inhabits heavily vegetated standing to slow-flowing fresh and brackish water. Feeds on worms, crustaceans and plant matter (Ref. 7020). A truly viviparous fish (Ref. 45952).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range includes the lower southeastern North American Coastal Plain from the Cape Fear River drainage in extreme southeastern North Carolina to southeastern Texas (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Range includes the lower southeastern North American Coastal Plain from the Cape Fear River drainage in extreme southeastern North Carolina to southeastern Texas (Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: occurs only in the USA from Cape Fear River drainage in North Carolina to southern Louisiana.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 3 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 36 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

3.6 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes heavily vegetated, standing and slow-flowing waters; weedy pond and stream margins, marshes; from fresh to brackish (about 30 ppt) water (Lee et al. 1980, Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes heavily vegetated, standing and slow-flowing waters; weedy pond and stream margins, marshes; from fresh to brackish (about 30 ppt) water (Lee et al. 1980, Page and Burr 2011).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; brackish; pH range: 7.0 - 8.0; dH range: 9 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.05 - 0.05
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on attached zooplankton and insect larvae in densely vegetated areas; ingested plant material may be mostly a result of foraging on attached zooplankton (Reimer, 1970, Am. Midl. Nat. 83:311-315).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits heavily vegetated standing to slow-flowing fresh and brackish water. Feeds on worms, crustaceans and plant matter.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Heterandria formosa (nematodes, mosquito fish, least killifish) is prey of:
Decapoda
Floridichthys carpio
Lophogobius cyprinoides

Based on studies in:
USA: Florida, Everglades (Estuarine)

This list may not be complete but is based on published studies.
  • W. E. Odum and E. J. Heald, The detritus-based food web of an estuarine mangrove community, In Estuarine Research, Vol. 1, Chemistry, Biology and the Estuarine System, Academic Press, New York, pp. 265-286, from p. 281 (1975).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Heterandria formosa (nematodes, mosquito fish, least killifish) preys on:
algae
phytoplankton
Nematoda
Crustacea
Polychaeta
Bivalvia
Actinopterygii
Cumacea

Based on studies in:
USA: Florida, Everglades (Estuarine)

This list may not be complete but is based on published studies.
  • W. E. Odum and E. J. Heald, The detritus-based food web of an estuarine mangrove community, In Estuarine Research, Vol. 1, Chemistry, Biology and the Estuarine System, Academic Press, New York, pp. 265-286, from p. 281 (1975).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large. This species is common; abundant throughout peninsular Florida (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Populatio age structure may be significantly impacted through predation by GAMBUSIA HOLBROOKI on small HETERANDRIA (Schaefer et al., Copeia 1994:516-520).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

A truly viviparous fish, embryo derives nearly all of its nourishment from the mother (Ref. 45952).
  • Able, K.W. 1984 Cyprinodontiformes: development. p. 362-368. In American Society of Ichthyologists and Herpetologists. Ontogeny and systematics of fishes, based on an international symposium dedicated to the memory of E.H. Ahlstrom, 15-18 August 1983, La Jolla, California. Spec. Publ. Am. Soc. Ichthyol. Herpetol. (1):1-760. (Ref. 45896)   http://www.fishbase.org/references/FBRefSummary.php?id=45896&speccode=3224 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

See Scrimshaw (1944, Copeia:180-183) for information on reproduction.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heterandria formosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCATGAGCCGGAATGGTCGGGACGGCCCTGAGCCTCTTGATCCGGGCGGAACTCAGTCAGCCAGGGTCCCTCCTGGGTGACGACCAGATTTATAACGTCATTGTCACGGCCCATGCTTTTGTAATAATCTTCTTTATAGTTATGCCAATCATGATCGGTGGTTTTGGTAATTGGCTAGTCCCCCTAATAATTGGCGCCCCCGACATAGCCTTCCCCCGCATGAACAACATAAGCTTCTGACTTCTACCCCCCTCTTTTCTCCTCCTCCTAGCATCCTCCGGGGTCGAAGCCGGGGCTGGGACAGGGTGGACTGTTTACCCCCCCCTCGCAGGCAATTTAGCTCATGCTGGGGCTTCCGTAGACTTAACTATCTTCTCCCTCCACTTAGCGGGCATTTCCTCTATTTTGGGGGCAATCAACTTTATCACTACTATTATTAATATAAAACCCCCTGCAGCATCCCAATACCAGACCCCTCTATTTGTTTGAGCAGTTTTAATCACAGCCGTCCTTCTGCTTCTCTCCCTTCCCGTTCTCGCCGCAGGCATCACCATACTTCTCACAGATCGGAACCTAAACACCACCTTCTTTGACCCTGCAGGTGGGGGGGACCCTATCCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heterandria formosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large. This species is common; abundant throughout peninsular Florida (Page and Burr 2011).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Heterandria formosa

Heterandria formosa (known as the least killifish, mosqu or midget livebearer)[2] is a species of livebearing fish within the family Poeciliidae. This is the same family that includes familiar aquarium fishes such as guppies and mollies. H. formosa is not as commonly kept in aquaria as these species. H. formosa is one of the smallest fish in the world (7th smallest as of 1991),[3] and is the smallest fish found in North America.[4] Despite the common name "least killifish", it belongs to the family Poeciliidae and not to one of the killifish families.

Range and habitat[edit]

Heterandria formosa is the only member of its genus to be found in the United States.[5] Its range covers southeastern United States, from South Carolina south to Georgia and Florida, and through the Florida Gulf Coast to Louisiana.[5][6] It is one of the few aquarium fishes to come from North America.

H. formosa lives primarily in vegetated, slow moving or standing freshwater but also occurs in brackish waters.[6]

Description[edit]

Heterandria formosa is one of the smallest fish and smallest vertebrates known to science.[5] Males grow to about 2 centimeters (0.8 inches), while females grow a little larger, to about 3 centimeters (1.2 inches).[5][7]

The fish is generally an olive color, with a dark horizontal stripe through the center of the body. There is also a dark spot on the dorsal fin and females also have a dark spot on their anal fin. Like most poeciliids, males' anal fins are modified into a gonopodium that is used for impregnating females during mating.

Diet[edit]

Heterandria formosa primarily eats invertebrates such as worms and crustaceans.[6] They also eat plant matter.[6]

Breeding[edit]

Like most poeciliids, H. formosa is a livebearer. The male uses his modified anal fin, or gonopodium, to deliver sperm to the female. The fertilized eggs grow within the female until they hatch, and the young are released free swimming. H. formosa has an uncommon breeding strategy even among livebearers. Rather than all the young being released at once, as many as 40 fry are released over a 10 to 14 day period, but occasionally over a longer period.[3][5][7]

References[edit]

  1. ^ Nicolas Bailly (2010). "Heterandria formosa Girard, 1859". In Nicolas Bailly. FishBase. World Register of Marine Species. Retrieved May 29, 2012. 
  2. ^ "Common names of Heterandria formosa". FishBase. Retrieved May 29, 2012. 
  3. ^ a b Baensch, H. (1991). Baensch Aquarium Atlas. pp. 592–593. ISBN 3-88244-050-3. 
  4. ^ Jason C. Chaney & David L. Bechler (2006). "The occurrence and distribution of Heterandria formosa (Teleostei, Poeciliidae) in Lowndes County, Georgia" (PDF). Georgia Journal of Science 64 (2): 67–75. 
  5. ^ a b c d e Dawes, J. (1995). Livebearing Fishes. pp. 186–187. ISBN 0-7137-2592-3. 
  6. ^ a b c d "Fishbase Heterandria formosa". Retrieved 2008-08-10. 
  7. ^ a b Dawes, J. (2001). Complete Encyclopedia of the Freshwater Aquarium. p. 276. ISBN 1-55297-544-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: "Populations in the northeast have lower genetic diversity than those to the south and west and show no isolation by distance" (Baer 1998).

The only other member of the genus occurs in Middle America (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!