Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: flounder (English), lenguado (Espanol)
 
Bothus mancus (Broussonet, 1782)



Tropical flounder,     Flowery flounder

Body deep (~ 50% of SL); male with spines on snout and above eye, & tentacles on eyes; eyes on left side of head; wide and flat between eyes, much wider than eye in males; lower eye well before top eye; mouth moderate to small; male with a strong, stout nasal spine and a few small spines on ridges around eye; teeth small, on both sides of both jaws; 9-11 long, slender gill rakers, all on lower part of gill arch; dorsal fin origin well before top eye; dorsal rays 96-104; anal rays 74-81; eye side pectoral larger than blind side fin; male with very elongate pectoral fin on eyed side; eye side pelvic with origin under lower eye, and much longer base than fin of blind side; lateral line on eye side only, with distinct arch over eye side pectoral fin; scales small, rough on eye side, smooth on blind side; lateral-line scales 85-90.

Brown with numerous variable-sized white to pale blue spots, some forming small partial circles; also scattered dark brown spots present;  3 dark blotches along lateral line; blind side white, with small brown spots on operculum, rear 1/3 of body grey.


Size: reaches 42 cm.

Habitat: sand and rubble bottoms but also on rock and coral.

Depth: 0-150 m.

Widely distributed in the tropical Indo-Pacific; Panama, the mouth of the Gulf of California; the Revillagigedos, Clipperton, Cocos, Malpelo and the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabit sandy bottoms of coastal coral reefs (Ref. 5213, 48637), generally in shallow water (Ref. 9281). Benthic (Ref. 58302). Hunt mostly at night, but also active during the day. Often crawling over low rocky reef (Ref. 48637). Occasionally rest on bare rock (Ref. 1602). Feed on fishes, crabs and shrimps. Collected by divers (Ref. 9824).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Bothus mancus is widely distributed in the Indo-pacific, from East Africa to Central America. In the tropical eastern Pacific there are several records scattered from the mainland including the tip of Baja California, southern Mexico, Panama, and Ecuador, and at all the oceanic islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 150 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: in tropical waters, from South Africa to Hawaii and Easter Island, north to southern Japan and south to Lord Howe Island. Eastern Pacific: Revillagigedo, Clipperton and Cocos islands (Ref. 9281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, South Africa, Seychelles, Seychelles, Madagascar and Mascarenes east to Mexico, north to Ryukyu Islands, Ogasawara Islands and Hawaiian Islands, south to Lord Howe Island, New Caledonia, Rapa and Ducie (Pitcairn Group)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 42.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 96 - 104; Analspines: 0; Analsoft rays: 74 - 81
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 420 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

51.0 cm NG (male/unsexed; (Ref. 89467)); max. published weight: 1,750 g (Ref. 89467)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits sandy bottoms of coral reef areas of coastal waters (Ref. 5213). Occasionally rests on bare rock (Ref. 1602). Feeds on fishes, crabs and shrimps. Collected by divers (Ref. 9824).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eyed side with dark margined light colored spots and numerous scattered small dark spots; normally with 3 dark blotches or spots on lateral line; dorsal and anal fins with longitudinal row of widely-spaced dark spots; pectorals of the eyed side with dark crossbars (Ref. 4417).Description: Characterized further by pale brown to light grey body color; pectoral rays on eyed side, greatly prolonged in male, sometimes reaching as far posteriorly as caudal fin; weakly ctenoid scales or cycloid on eyed side, cycloid on blind side; short gill rakers; eyes of male with short tentacle; lower jaw extending to below front edge of lower eye or slightly posterior; mature male with spines on snout and on upper and lower orbital ridges; depth of body 1.7-25.1 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Bothus mancus lives on sand near coral reefs and reef flats (FAO 2001), and is also found on gravel substrata. It feeds on small benthic crustaceans and fishes. This species is commonly observed in shallow water but can be found to 150 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 53 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0.305 - 515
  Temperature range (°C): 23.233 - 29.336
  Nitrate (umol/L): 0.016 - 5.562
  Salinity (PPS): 33.044 - 36.148
  Oxygen (ml/l): 4.243 - 4.807
  Phosphate (umol/l): 0.092 - 0.643
  Silicate (umol/l): 0.912 - 4.752

Graphical representation

Depth range (m): 0.305 - 515

Temperature range (°C): 23.233 - 29.336

Nitrate (umol/L): 0.016 - 5.562

Salinity (PPS): 33.044 - 36.148

Oxygen (ml/l): 4.243 - 4.807

Phosphate (umol/l): 0.092 - 0.643

Silicate (umol/l): 0.912 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 150 m (Ref. 9281)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 53 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0.305 - 515
  Temperature range (°C): 23.233 - 29.336
  Nitrate (umol/L): 0.016 - 5.562
  Salinity (PPS): 33.044 - 36.148
  Oxygen (ml/l): 4.243 - 4.807
  Phosphate (umol/l): 0.092 - 0.643
  Silicate (umol/l): 0.912 - 4.752

Graphical representation

Depth range (m): 0.305 - 515

Temperature range (°C): 23.233 - 29.336

Nitrate (umol/L): 0.016 - 5.562

Salinity (PPS): 33.044 - 36.148

Oxygen (ml/l): 4.243 - 4.807

Phosphate (umol/l): 0.092 - 0.643

Silicate (umol/l): 0.912 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 150m.
Recorded at 150 meters.

Habitat: reef-associated. Tropical flounder.  (Broussonet, 1782)  Attains 42 cm. Widely distributed from Durban to Hawaii and Easter Islands. Found in shallow water on sandy bottoms or flat reef areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits sandy bottoms of coastal coral reefs (Ref. 5213, 48637), generally in shallow water (Ref. 9281). Hunt mostly at night, but also active during the day. Often crawling over low rocky reef (Ref. 48637). Occasionally rests on bare rock (Ref. 1602). Feeds on fishes, crabs and shrimps. Mobile-invertebrate feeder (Ref. 57615).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bothus mancus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTCGTATTCGGTGCTTGAGCGGGCATGGTCGGGACCGCGCTTAGCCTTCTTATCCGAGCTGAGCTCAGCCAGCCCGGGGCCCTGCTGGGCGACGACCAGATTTATAATGTCATCGTCACGGCCCATGCGTTCGTGATGATCTTCTTTATAGTAATGCCTATTATGATCGGGGGCTTTGGTAACTGGCTAATCCCCCTGATGGTGGGGGCCCCCGATATGGCATTCCCCCGCATAAACAACATGAGCTTCTGACTACTTCCCCCCTCTTTCCTCCTCCTGTTAGCCTCCTCTGGGGTAGAGGCAGGGGCGGGGACCGGGTGGACTGTCTACCCCCCATTGGCGGGCAATCTTGCACACGCCGGAGCATCAGTAGACCTAACTATCTTCTCTCTACACCTCGCGGGTATCTCGTCCATCTTGGGGGCCATCAACTTCATTACCACAATTTTGAACATGAAGCCGCCGGCTATGACGATGTACCAGGTTCCGCTGTTCGTCTGGGCAGTCCTAATCACTGCGGTCCTCCTACTGCTTTCCCTACCAGTGCTCGCAGCAGGAATCACCATGCTCCTGACAGACCGAAACTTAAACACTACCTTCTTCGACCCGGCCGGAGGGGGGGACCCAATTCTATACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bothus mancus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Fricke, R., Munroe, T., Nielsen, J.G. & Tyler, J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Bothus mancus is assessed as Least Concern owing to its widespread distribution in the Indian and Pacific Oceans. While it is harvested as a food source, this is not known across this species entire range and the fishery is not of sufficient scale to result in a significant population decline. Many of the eastern Pacific subpopulations are contained within marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is harvested as a food source in some parts of its range, however this is not considered a major threat at present due to the small scale of the fishery. There are no other known major threats to this broadly distributed species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Bothus mancus. However the distribution of this species falls within numerous designated marine protected areas in the Indian and Pacific Oceans, including the Hawaiian islands National Wildlife Refuge, which covers an area of 2,500 km and is a no-take zone. In the eastern Pacific much of the distribution of this species is contained within marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Peacock flounder

This article is about the Indo-Pacific species. For the Atlantic, see Bothus lunatus.

The peacock flounder (Bothus mancus), also known as the flowery flounder, is a species of fish in the family Bothidae (lefteye flounders). The species is found widely in relatively shallow waters in the Indo-Pacific, also ranging into warmer parts of the east Pacific.[1]

Description[edit]

Peacock flounder

The peacock flounder is also called flowery flounder because it is covered in superficially flower-like bluish spots. As suggested by the family name, lefteye flounders have both eyes on top of the left hand side of their heads. The eyes are raised up on short stumps like radar dishes, and can move in any direction independent of each other. That feature provides flounders with a wide range of view. One eye can look forward while the other looks backward at the same time. The baby flounders have one eye on each side of their bodies like ordinary fish, and swim like other fishes do, but later on, as they are becoming adult, the right eye moves to the left side, and flounders start to swim sideways, which gives them the ability to settle down flat on the bottom.[2][3] The maximum length of this flounder is about 45 centimetres (18 in).[1]

Habitat[edit]

Peacock flounders are mostly found in shallow water on sandy bottoms. Sometimes they rest over piles of dead corals or bare rock. They may be found as deep as 150 meters (490 ft).[3]

Behavior[edit]

Diet[edit]

As most flounders, the peacock flounder is mainly nocturnal,[1] but is sometimes also active during the day.[2] It hunts for small fishes, crabs and shrimps.[2]

Reproduction[edit]

Peacock flounders breed in late winter and early spring. After the female releases two to three million eggs, males fertilize them. The fertilized eggs float close to the surface carried by the currents, and hatch in 15 days. Before hatching the eggs sink to the bottom. For the next four to six months baby flounders float in the open ocean, sometimes hundreds of miles from the place the eggs were released and hatched. During those months the right eye of the juvenile slowly moves to the left side.[2]

Color change[edit]

Four frames of the same fish taken a few minutes apart showing the ability of flounders to change colors to match the surroundings
If one of the eyes is damaged or covered by sand, flounders have difficulties in matching their colors to the surroundings

Like all flounders, peacock flounders are masters of camouflage. They use cryptic coloration to avoid being detected by both prey and predators. Whenever possible rather than swim they crawl on their fins along the bottom while constantly changing colors and patterns. In a study, peacock flounders demonstrated the ability to change colors in just eight seconds. They were even able to match the pattern of a checkerboard they were placed on. The changing of the colors is an extremely complex and not well understood process. It involves the flounder's vision and hormones. The flounders match the colors of the surface by releasing different pigments to the surface of the skin cells while leaving some of the cells white by suppressing those pigments. If one of the flounder's eyes is damaged or covered by sand, the flounders have difficulties in matching their colors to their surroundings. Whenever hunting or hiding from predators, the flounders bury themselves into the sand leaving only the eyes protruding.[2][4][5]

References[edit]

  1. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2010). "Bothus mancus" in FishBase. April 2010 version.
  2. ^ a b c d e "Peacock Flounder". 
  3. ^ a b "Bothus_mancus". Retrieved 2010-04-28. 
  4. ^ "Camouflage under water". Retrieved 2010-04-28. 
  5. ^ David A. Ross. The fisherman's ocean. p. 136. Retrieved 2010-04-28. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!